Incidental Mutation 'R5984:Invs'
ID481552
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Nameinversin
Synonyms
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R5984 (G1)
Quality Score223.009
Status Not validated
Chromosome4
Chromosomal Location48279760-48431954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48421674 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 769 (A769T)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
Predicted Effect probably benign
Transcript: ENSMUST00000030029
AA Change: A769T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: A769T

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48402909 missense probably damaging 0.98
IGL00487:Invs APN 4 48407689 nonsense probably null
IGL01487:Invs APN 4 48398136 missense probably benign 0.26
IGL01696:Invs APN 4 48425997 missense probably damaging 1.00
IGL02238:Invs APN 4 48390029 missense probably damaging 1.00
IGL03286:Invs APN 4 48382261 missense probably benign 0.26
R0645:Invs UTSW 4 48407653 missense probably benign 0.00
R0661:Invs UTSW 4 48421861 missense probably benign
R0698:Invs UTSW 4 48396364 missense probably benign 0.04
R0763:Invs UTSW 4 48392628 missense possibly damaging 0.82
R1183:Invs UTSW 4 48421725 missense possibly damaging 0.68
R1381:Invs UTSW 4 48421942 nonsense probably null
R1511:Invs UTSW 4 48382148 missense possibly damaging 0.82
R1843:Invs UTSW 4 48422035 missense probably damaging 0.96
R1903:Invs UTSW 4 48402824 splice site probably null
R1928:Invs UTSW 4 48390095 missense probably damaging 1.00
R1990:Invs UTSW 4 48392599 missense possibly damaging 0.88
R2063:Invs UTSW 4 48396287 missense probably damaging 1.00
R2064:Invs UTSW 4 48396287 missense probably damaging 1.00
R2065:Invs UTSW 4 48396287 missense probably damaging 1.00
R2066:Invs UTSW 4 48396287 missense probably damaging 1.00
R4744:Invs UTSW 4 48397609 missense probably damaging 1.00
R4997:Invs UTSW 4 48396332 missense probably damaging 0.98
R5011:Invs UTSW 4 48421807 missense probably damaging 1.00
R5013:Invs UTSW 4 48421807 missense probably damaging 1.00
R5083:Invs UTSW 4 48396307 missense possibly damaging 0.90
R5184:Invs UTSW 4 48283242 utr 5 prime probably benign
R5258:Invs UTSW 4 48396374 missense possibly damaging 0.82
R5375:Invs UTSW 4 48385262 missense probably benign 0.12
R5509:Invs UTSW 4 48396337 missense probably damaging 1.00
R5560:Invs UTSW 4 48416084 missense probably benign 0.00
R5748:Invs UTSW 4 48307823 missense probably damaging 0.98
R5813:Invs UTSW 4 48398146 missense probably damaging 0.98
R5840:Invs UTSW 4 48396284 missense probably damaging 1.00
R6513:Invs UTSW 4 48397534 missense possibly damaging 0.46
R6637:Invs UTSW 4 48416203 splice site probably null
R6667:Invs UTSW 4 48402870 missense possibly damaging 0.66
R6838:Invs UTSW 4 48283278 missense possibly damaging 0.95
R6921:Invs UTSW 4 48396260 missense possibly damaging 0.46
R6945:Invs UTSW 4 48421785 missense probably benign 0.00
R7102:Invs UTSW 4 48407674 missense probably benign 0.21
R7142:Invs UTSW 4 48407696 missense probably damaging 1.00
R7263:Invs UTSW 4 48396381 missense probably damaging 1.00
R7283:Invs UTSW 4 48392526 intron probably null
R7461:Invs UTSW 4 48392668 missense probably damaging 1.00
R7503:Invs UTSW 4 48396347 missense probably damaging 0.96
R7581:Invs UTSW 4 48421909 missense probably benign 0.00
R7613:Invs UTSW 4 48392668 missense probably damaging 1.00
R7861:Invs UTSW 4 48397559 missense possibly damaging 0.50
R7944:Invs UTSW 4 48397559 missense possibly damaging 0.50
X0026:Invs UTSW 4 48398221 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACCCATAGAGCACTGCAGAG -3'
(R):5'- AGAGAACTCTGATCAGCACAG -3'

Sequencing Primer
(F):5'- TGTGTGCACCCCAGATCCTG -3'
(R):5'- TCTGATCAGCACAGGCAAC -3'
Posted On2017-06-26