Incidental Mutation 'R5984:Fgfr3'
ID481554
Institutional Source Beutler Lab
Gene Symbol Fgfr3
Ensembl Gene ENSMUSG00000054252
Gene Namefibroblast growth factor receptor 3
Synonymssam3, Fgfr-3, HBGFR
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R5984 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33721674-33737068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33729705 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 151 (E151V)
Ref Sequence ENSEMBL: ENSMUSP00000144379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067150] [ENSMUST00000087820] [ENSMUST00000114411] [ENSMUST00000155002] [ENSMUST00000164207] [ENSMUST00000169212] [ENSMUST00000171509] [ENSMUST00000201295] [ENSMUST00000201437] [ENSMUST00000202138]
Predicted Effect probably damaging
Transcript: ENSMUST00000067150
AA Change: E151V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070998
Gene: ENSMUSG00000054252
AA Change: E151V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087820
AA Change: E133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085122
Gene: ENSMUSG00000054252
AA Change: E133V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114411
AA Change: E151V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110053
Gene: ENSMUSG00000054252
AA Change: E151V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152661
Predicted Effect probably benign
Transcript: ENSMUST00000155002
Predicted Effect probably damaging
Transcript: ENSMUST00000164207
AA Change: E151V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133064
Gene: ENSMUSG00000054252
AA Change: E151V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 467 743 3.14e-153 SMART
low complexity region 766 782 N/A INTRINSIC
low complexity region 790 799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169212
AA Change: E151V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130856
Gene: ENSMUSG00000054252
AA Change: E151V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 340 3.28e-8 SMART
transmembrane domain 367 389 N/A INTRINSIC
TyrKc 466 742 3.14e-153 SMART
low complexity region 765 781 N/A INTRINSIC
low complexity region 789 798 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171509
AA Change: E151V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131845
Gene: ENSMUSG00000054252
AA Change: E151V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
low complexity region 125 144 N/A INTRINSIC
IGc2 161 229 1.2e-15 SMART
IGc2 260 339 2.77e-6 SMART
transmembrane domain 369 391 N/A INTRINSIC
TyrKc 468 744 3.14e-153 SMART
low complexity region 767 783 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181298
Predicted Effect probably benign
Transcript: ENSMUST00000201295
SMART Domains Protein: ENSMUSP00000144104
Gene: ENSMUSG00000054252

DomainStartEndE-ValueType
IG 11 71 1.9e-3 SMART
transmembrane domain 90 112 N/A INTRINSIC
PDB:2PSQ|B 126 223 2e-30 PDB
Blast:IG_like 140 223 2e-51 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000201437
AA Change: E151V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144379
Gene: ENSMUSG00000054252
AA Change: E151V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 2e-6 SMART
Pfam:Ig_3 144 194 2.1e-3 PFAM
Pfam:I-set 153 194 9.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202138
AA Change: E133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143945
Gene: ENSMUSG00000054252
AA Change: E133V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 50 114 5.01e-4 SMART
IGc2 143 211 1.2e-15 SMART
IGc2 242 322 3.28e-8 SMART
transmembrane domain 349 371 N/A INTRINSIC
TyrKc 448 724 3.14e-153 SMART
low complexity region 747 763 N/A INTRINSIC
low complexity region 771 780 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202182
AA Change: E139V
Predicted Effect probably benign
Transcript: ENSMUST00000202791
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the fibroblast growth factor receptor family. Members of this family are highly conserved proteins that differ from one another in their ligand affinities and tissue distribution. A representative protein consists of an extracellular region composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene may be associated with craniosynostosis and multiple types of skeletal dysplasia. A pseudogene of this gene is located on chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mutant alleles generally cause skeletal deformities, with some causing decreased body size, premature death, or hearing loss due to developmental defects of the ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Fgfr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Fgfr3 APN 5 33735140 missense possibly damaging 0.57
IGL01585:Fgfr3 APN 5 33733961 missense probably damaging 0.96
IGL03266:Fgfr3 APN 5 33734365 missense probably damaging 1.00
IGL03285:Fgfr3 APN 5 33735213 missense probably damaging 1.00
PIT4280001:Fgfr3 UTSW 5 33732232 missense probably benign 0.13
R0543:Fgfr3 UTSW 5 33729710 start codon destroyed probably null 0.00
R0604:Fgfr3 UTSW 5 33732782 missense probably damaging 0.99
R1496:Fgfr3 UTSW 5 33729750 missense probably damaging 0.96
R1861:Fgfr3 UTSW 5 33729746 missense probably damaging 1.00
R2919:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R2920:Fgfr3 UTSW 5 33733940 missense probably damaging 1.00
R4361:Fgfr3 UTSW 5 33723332 intron probably benign
R4506:Fgfr3 UTSW 5 33729999 missense probably damaging 1.00
R4513:Fgfr3 UTSW 5 33723116 intron probably benign
R4647:Fgfr3 UTSW 5 33734986 unclassified probably benign
R5240:Fgfr3 UTSW 5 33730038 missense probably damaging 1.00
R5251:Fgfr3 UTSW 5 33735556 unclassified probably benign
R5454:Fgfr3 UTSW 5 33723298 intron probably benign
R5595:Fgfr3 UTSW 5 33730003 missense probably damaging 1.00
R6753:Fgfr3 UTSW 5 33732159 missense probably benign 0.35
R6985:Fgfr3 UTSW 5 33735441 missense probably null 1.00
R7106:Fgfr3 UTSW 5 33731414 missense probably damaging 1.00
R7221:Fgfr3 UTSW 5 33732748 frame shift probably null
R7319:Fgfr3 UTSW 5 33727802 missense possibly damaging 0.88
R7373:Fgfr3 UTSW 5 33727690 missense probably benign 0.00
R7497:Fgfr3 UTSW 5 33735422 frame shift probably null
R7498:Fgfr3 UTSW 5 33735422 frame shift probably null
R7499:Fgfr3 UTSW 5 33735422 frame shift probably null
R7883:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
R7966:Fgfr3 UTSW 5 33733891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATCTGAGAGTAGGGCAAC -3'
(R):5'- GGAGCTGCAGGTAGTTAGTC -3'

Sequencing Primer
(F):5'- GCAACTGGTAATGCAGTGTCC -3'
(R):5'- CTGTGAGTAGATGCAGACTATCCC -3'
Posted On2017-06-26