Incidental Mutation 'R5984:Crlf2'
ID481555
Institutional Source Beutler Lab
Gene Symbol Crlf2
Ensembl Gene ENSMUSG00000033467
Gene Namecytokine receptor-like factor 2
SynonymsLy114, Tpte2, Tslpr
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R5984 (G1)
Quality Score171.009
Status Not validated
Chromosome5
Chromosomal Location109554709-109558993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109555603 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 92 (P92L)
Ref Sequence ENSEMBL: ENSMUSP00000142982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044579] [ENSMUST00000198960] [ENSMUST00000200284]
Predicted Effect probably damaging
Transcript: ENSMUST00000044579
AA Change: P225L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036326
Gene: ENSMUSG00000033467
AA Change: P225L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 84 102 N/A INTRINSIC
FN3 117 196 2.58e-4 SMART
low complexity region 210 253 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196881
Predicted Effect probably damaging
Transcript: ENSMUST00000198960
AA Change: P92L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142982
Gene: ENSMUSG00000033467
AA Change: P92L

DomainStartEndE-ValueType
Blast:FN3 1 52 2e-30 BLAST
SCOP:d1eerb2 1 65 7e-8 SMART
PDB:4NN7|C 1 66 2e-41 PDB
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200284
AA Change: P223L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143641
Gene: ENSMUSG00000033467
AA Change: P223L

DomainStartEndE-ValueType
low complexity region 82 100 N/A INTRINSIC
FN3 115 194 1.3e-6 SMART
low complexity region 208 251 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are overtly normal and maintain normal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Crlf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Crlf2 APN 5 109557570 missense possibly damaging 0.66
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0732:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0898:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R1277:Crlf2 UTSW 5 109557600 missense possibly damaging 0.46
R1674:Crlf2 UTSW 5 109558803 critical splice donor site probably null
R1912:Crlf2 UTSW 5 109557141 missense possibly damaging 0.83
R5276:Crlf2 UTSW 5 109557635 unclassified probably benign
R5418:Crlf2 UTSW 5 109557033 missense probably benign 0.05
R6848:Crlf2 UTSW 5 109557031 missense possibly damaging 0.66
R7437:Crlf2 UTSW 5 109554973 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACATGACGTCATCACAGTGGTG -3'
(R):5'- TGCACTTGGGTGACTGACAG -3'

Sequencing Primer
(F):5'- TGACGTCATCGCCGTAGACATC -3'
(R):5'- ATGAACTCATCGGCTCCTGGATG -3'
Posted On2017-06-26