Mutagenetix > Incidental Mutations

Incidental Mutation 'R5984:Ptpn21'

481572

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPD1, PTPRL10

MMRRC Submission

043251-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R5984 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98676741-98737405 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98689076 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 544 (N544I)

Ref Sequence

ENSEMBL: ENSMUSP00000152639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085116
AA Change: N544I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: N544I

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170188
AA Change: N544I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: N544I

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221148

Predicted Effect

probably benign
Transcript: ENSMUST00000221535

Predicted Effect

probably damaging
Transcript: ENSMUST00000221932
AA Change: N544I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9830107B12Rik	T	A	17: 48,128,555	L130F	probably benign	Het
Alox12	T	C	11: 70,247,055	T420A	possibly damaging	Het
Ano5	T	C	7: 51,593,664	I795T	probably damaging	Het
Crlf2	G	A	5: 109,555,603	P92L	probably damaging	Het
Dgat1	T	C	15: 76,502,258	Y492C	probably damaging	Het
Dna2	G	C	10: 62,962,506		probably null	Het
Dst	A	G	1: 34,172,263	H982R	probably benign	Het
F13b	A	G	1: 139,508,212	D252G	probably damaging	Het
Fam173b	C	T	15: 31,616,919	R99*	probably null	Het
Fgfr3	A	T	5: 33,729,705	E151V	probably damaging	Het
Gabpb1	T	C	2: 126,646,653	T264A	probably damaging	Het
Gemin5	T	C	11: 58,156,761	E329G	probably damaging	Het
Git1	C	T	11: 77,506,483	P721S	possibly damaging	Het
Hcn3	T	C	3: 89,148,263	E559G	probably benign	Het
Invs	G	A	4: 48,421,674	A769T	probably benign	Het
Ism2	T	A	12: 87,287,035	T79S	possibly damaging	Het
Lamb1	G	A	12: 31,327,774	E1673K	possibly damaging	Het
Lmtk2	T	A	5: 144,174,838	L792H	probably benign	Het
Lnpk	A	T	2: 74,522,199	S380T	probably benign	Het
Mff	A	G	1: 82,731,127	I66V	probably benign	Het
Mtor	A	G	4: 148,538,827	K2045E	probably benign	Het
Mycbp2	C	A	14: 103,126,684	W4393L	probably damaging	Het
Olfr1079	A	T	2: 86,538,168	V249E	probably damaging	Het
Olfr391-ps	T	A	11: 73,799,581	M59L	possibly damaging	Het
Pcdha5	A	G	18: 36,961,680	D414G	probably damaging	Het
Pknox2	T	C	9: 36,923,726	E149G	probably damaging	Het
Plxdc2	A	G	2: 16,660,855	R240G	probably benign	Het
Polr3d	A	T	14: 70,439,487	F389Y	possibly damaging	Het
Prex1	T	G	2: 166,585,744	D826A	probably damaging	Het
Prss50	T	A	9: 110,862,386	S253T	probably damaging	Het
Ptgfrn	T	C	3: 101,050,143	D705G	probably damaging	Het
Rbm5	G	A	9: 107,744,942	P611L	probably damaging	Het
Rev3l	A	T	10: 39,742,689		probably benign	Het
Rnf139	T	C	15: 58,898,746	Y207H	probably benign	Het
Scn11a	C	T	9: 119,784,016	R836H	probably benign	Het
Slc30a1	A	G	1: 191,907,100	T32A	probably damaging	Het
Smad4	T	A	18: 73,677,911	M1L	probably benign	Het
Sos1	T	C	17: 80,452,132	D190G	possibly damaging	Het
Sptbn1	C	T	11: 30,118,464	D1677N	probably damaging	Het
Tmem132e	G	A	11: 82,445,097	D1002N	probably damaging	Het
Usp8	C	A	2: 126,742,481	Q526K	probably benign	Het
Wt1	A	G	2: 105,172,252	S488G	probably benign	Het
Zbtb43	A	G	2: 33,454,260	S318P	probably benign	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98680468	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98733601	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98688313	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98680371	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98715189	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98680013	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98689161	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98705092	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98679392	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98715195	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98689632	splice site	probably benign
IGL03024:Ptpn21	APN	12	98680056	missense	probably benign
IGL03220:Ptpn21	APN	12	98678623	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98688609	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98704240	splice site	probably benign
R0675:Ptpn21	UTSW	12	98688216	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98689080	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98688590	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1470:Ptpn21	UTSW	12	98688476	missense	probably benign
R1837:Ptpn21	UTSW	12	98733626	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98680405	splice site	probably null
R2048:Ptpn21	UTSW	12	98689526	missense	possibly damaging	0.94
R2376:Ptpn21	UTSW	12	98688314	missense	possibly damaging	0.62
R3709:Ptpn21	UTSW	12	98688541	missense	probably benign
R4197:Ptpn21	UTSW	12	98680138	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98733475	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98678593	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98688248	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98715060	missense	probably damaging	0.98
R4703:Ptpn21	UTSW	12	98679392	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98708844	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98689296	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98715195	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98680103	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98679407	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98715117	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98688777	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98679289	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98682550	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98708889	splice site	probably null
R5968:Ptpn21	UTSW	12	98710890	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98678552	makesense	probably null
R6181:Ptpn21	UTSW	12	98699999	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98680116	missense	probably benign	0.24
R6226:Ptpn21	UTSW	12	98715172	missense	probably damaging	1.00
R6317:Ptpn21	UTSW	12	98689262	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98689034	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98698872	nonsense	probably null
R6894:Ptpn21	UTSW	12	98715181	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98688912	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98688737	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98704191	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98680101	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98737363	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98688772	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98682532	missense	probably damaging	1.00
R7867:Ptpn21	UTSW	12	98705176	missense	probably damaging	1.00
R7878:Ptpn21	UTSW	12	98715128	missense	probably damaging	1.00
R7911:Ptpn21	UTSW	12	98688842	missense	probably damaging	0.99
R8100:Ptpn21	UTSW	12	98682622	missense	possibly damaging	0.61
R8199:Ptpn21	UTSW	12	98678582	missense	possibly damaging	0.92
R8272:Ptpn21	UTSW	12	98688530	missense	probably benign
R8481:Ptpn21	UTSW	12	98688894	missense	probably benign	0.03
R8535:Ptpn21	UTSW	12	98680026	missense	probably damaging	0.98
R8775:Ptpn21	UTSW	12	98682742	critical splice acceptor site	probably null
R8775-TAIL:Ptpn21	UTSW	12	98682742	critical splice acceptor site	probably null
Z1177:Ptpn21	UTSW	12	98688458	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGGTCTGCACTGAGTGATGGAC -3'
(R):5'- GAGGAACCTCAACATTGGCAG -3'

Sequencing Primer
(F):5'- ACGCGCCTGGTGATGAGATC -3'
(R):5'- CATTGGCAGTTCCTATGCGTACAG -3'

Posted On

2017-06-26