Incidental Mutation 'R5984:Polr3d'
ID481573
Institutional Source Beutler Lab
Gene Symbol Polr3d
Ensembl Gene ENSMUSG00000000776
Gene Namepolymerase (RNA) III (DNA directed) polypeptide D
SynonymsTSBN51, RPC4, 44kDa, 2810426M17Rik, BN51T
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5984 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70438757-70443447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70439487 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 389 (F389Y)
Ref Sequence ENSEMBL: ENSMUSP00000137614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000793] [ENSMUST00000180358]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000793
AA Change: F389Y

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000793
Gene: ENSMUSG00000000776
AA Change: F389Y

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 217 241 N/A INTRINSIC
Pfam:RNA_pol_Rpc4 263 389 7.9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083594
Predicted Effect possibly damaging
Transcript: ENSMUST00000180358
AA Change: F389Y

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137614
Gene: ENSMUSG00000000776
AA Change: F389Y

DomainStartEndE-ValueType
low complexity region 13 31 N/A INTRINSIC
low complexity region 78 99 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 217 241 N/A INTRINSIC
Pfam:RNA_pol_Rpc4 262 389 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227985
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements a temperature-sensitive mutant isolated from the BHK-21 Syrian hamster cell line. It leads to a block in progression through the G1 phase of the cell cycle at nonpermissive temperatures. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Polr3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02653:Polr3d APN 14 70440117 missense probably damaging 1.00
IGL03006:Polr3d APN 14 70441163 critical splice acceptor site probably null
PIT4449001:Polr3d UTSW 14 70439463 missense probably benign 0.27
R0568:Polr3d UTSW 14 70439519 missense possibly damaging 0.81
R1435:Polr3d UTSW 14 70440039 missense probably benign 0.22
R1710:Polr3d UTSW 14 70443010 missense probably benign 0.03
R1714:Polr3d UTSW 14 70441315 missense possibly damaging 0.90
R1748:Polr3d UTSW 14 70439475 nonsense probably null
R2136:Polr3d UTSW 14 70443047 frame shift probably null
R5506:Polr3d UTSW 14 70440759 missense possibly damaging 0.69
R6725:Polr3d UTSW 14 70441137 missense probably benign 0.00
R6880:Polr3d UTSW 14 70440015 missense probably benign 0.00
R7447:Polr3d UTSW 14 70439800 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAGGTCCCATTCACAGC -3'
(R):5'- TGGGGAAATATTAAACAGCCTGTG -3'

Sequencing Primer
(F):5'- ATTCACAGCTGGGGCGAG -3'
(R):5'- CCTGTGCTGAGGTGGCGAG -3'
Posted On2017-06-26