Incidental Mutation 'R5984:Fam173b'
ID481575
Institutional Source Beutler Lab
Gene Symbol Fam173b
Ensembl Gene ENSMUSG00000039065
Gene Namefamily with sequence similarity 173, member B
Synonyms
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R5984 (G1)
Quality Score192.009
Status Not validated
Chromosome15
Chromosomal Location31601852-31621227 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 31616919 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 99 (R99*)
Ref Sequence ENSEMBL: ENSMUSP00000124619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042702] [ENSMUST00000161061]
Predicted Effect probably null
Transcript: ENSMUST00000042702
AA Change: R177*
SMART Domains Protein: ENSMUSP00000039094
Gene: ENSMUSG00000039065
AA Change: R177*

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
SCOP:d1dusa_ 87 186 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160146
Predicted Effect probably null
Transcript: ENSMUST00000161061
AA Change: R99*
SMART Domains Protein: ENSMUSP00000124619
Gene: ENSMUSG00000039065
AA Change: R99*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pcdha5 A G 18: 36,961,680 D414G probably damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Fam173b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Fam173b APN 15 31606115 missense possibly damaging 0.89
IGL02715:Fam173b APN 15 31606003 missense probably benign 0.16
R0414:Fam173b UTSW 15 31617002 nonsense probably null
R0462:Fam173b UTSW 15 31616872 missense probably damaging 1.00
R0518:Fam173b UTSW 15 31605957 missense probably benign 0.05
R0521:Fam173b UTSW 15 31605957 missense probably benign 0.05
R1692:Fam173b UTSW 15 31602151 critical splice donor site probably null
R2141:Fam173b UTSW 15 31609572 missense probably benign 0.09
R4719:Fam173b UTSW 15 31608097 missense probably damaging 1.00
R6113:Fam173b UTSW 15 31608162 missense probably damaging 1.00
R6899:Fam173b UTSW 15 31617111 missense probably benign 0.03
R7575:Fam173b UTSW 15 31606040 missense probably damaging 1.00
R7577:Fam173b UTSW 15 31606040 missense probably damaging 1.00
R8024:Fam173b UTSW 15 31608171 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTTGATAAGTGCCTGTGC -3'
(R):5'- CACTCAACGTCAAGGAGCTTG -3'

Sequencing Primer
(F):5'- ATAAGTGCCTGTGCCTGCG -3'
(R):5'- CTCCGTGTCTCAGATGAGGAG -3'
Posted On2017-06-26