Incidental Mutation 'R5984:Pcdha5'
ID481580
Institutional Source Beutler Lab
Gene Symbol Pcdha5
Ensembl Gene ENSMUSG00000103092
Gene Nameprotocadherin alpha 5
SynonymsCnr6, Crnr6
MMRRC Submission 043251-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R5984 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36960440-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36961680 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 414 (D414G)
Ref Sequence ENSEMBL: ENSMUSP00000142293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192168
AA Change: D414G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092
AA Change: D414G

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik T A 17: 48,128,555 L130F probably benign Het
Alox12 T C 11: 70,247,055 T420A possibly damaging Het
Ano5 T C 7: 51,593,664 I795T probably damaging Het
Crlf2 G A 5: 109,555,603 P92L probably damaging Het
Dgat1 T C 15: 76,502,258 Y492C probably damaging Het
Dna2 G C 10: 62,962,506 probably null Het
Dst A G 1: 34,172,263 H982R probably benign Het
F13b A G 1: 139,508,212 D252G probably damaging Het
Fam173b C T 15: 31,616,919 R99* probably null Het
Fgfr3 A T 5: 33,729,705 E151V probably damaging Het
Gabpb1 T C 2: 126,646,653 T264A probably damaging Het
Gemin5 T C 11: 58,156,761 E329G probably damaging Het
Git1 C T 11: 77,506,483 P721S possibly damaging Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Invs G A 4: 48,421,674 A769T probably benign Het
Ism2 T A 12: 87,287,035 T79S possibly damaging Het
Lamb1 G A 12: 31,327,774 E1673K possibly damaging Het
Lmtk2 T A 5: 144,174,838 L792H probably benign Het
Lnpk A T 2: 74,522,199 S380T probably benign Het
Mff A G 1: 82,731,127 I66V probably benign Het
Mtor A G 4: 148,538,827 K2045E probably benign Het
Mycbp2 C A 14: 103,126,684 W4393L probably damaging Het
Olfr1079 A T 2: 86,538,168 V249E probably damaging Het
Olfr391-ps T A 11: 73,799,581 M59L possibly damaging Het
Pknox2 T C 9: 36,923,726 E149G probably damaging Het
Plxdc2 A G 2: 16,660,855 R240G probably benign Het
Polr3d A T 14: 70,439,487 F389Y possibly damaging Het
Prex1 T G 2: 166,585,744 D826A probably damaging Het
Prss50 T A 9: 110,862,386 S253T probably damaging Het
Ptgfrn T C 3: 101,050,143 D705G probably damaging Het
Ptpn21 T A 12: 98,689,076 N544I probably damaging Het
Rbm5 G A 9: 107,744,942 P611L probably damaging Het
Rev3l A T 10: 39,742,689 probably benign Het
Rnf139 T C 15: 58,898,746 Y207H probably benign Het
Scn11a C T 9: 119,784,016 R836H probably benign Het
Slc30a1 A G 1: 191,907,100 T32A probably damaging Het
Smad4 T A 18: 73,677,911 M1L probably benign Het
Sos1 T C 17: 80,452,132 D190G possibly damaging Het
Sptbn1 C T 11: 30,118,464 D1677N probably damaging Het
Tmem132e G A 11: 82,445,097 D1002N probably damaging Het
Usp8 C A 2: 126,742,481 Q526K probably benign Het
Wt1 A G 2: 105,172,252 S488G probably benign Het
Zbtb43 A G 2: 33,454,260 S318P probably benign Het
Other mutations in Pcdha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2483:Pcdha5 UTSW 18 36961489 missense probably benign
R2483:Pcdha5 UTSW 18 36961781 missense probably damaging 1.00
R2888:Pcdha5 UTSW 18 36961887 missense probably damaging 1.00
R2907:Pcdha5 UTSW 18 36960815 missense possibly damaging 0.59
R2981:Pcdha5 UTSW 18 36961476 missense probably damaging 1.00
R4468:Pcdha5 UTSW 18 36962180 missense probably benign 0.08
R4724:Pcdha5 UTSW 18 36961496 missense possibly damaging 0.61
R5280:Pcdha5 UTSW 18 36961702 nonsense probably null
R5412:Pcdha5 UTSW 18 36962457 missense probably benign 0.29
R5731:Pcdha5 UTSW 18 36960767 missense probably damaging 1.00
R5783:Pcdha5 UTSW 18 36962481 missense probably benign 0.00
R5865:Pcdha5 UTSW 18 36961421 missense probably benign 0.00
R6498:Pcdha5 UTSW 18 36962715 missense possibly damaging 0.52
R6719:Pcdha5 UTSW 18 36960872 missense probably damaging 1.00
R7084:Pcdha5 UTSW 18 36961562 missense probably benign 0.08
R7113:Pcdha5 UTSW 18 36961704 missense probably benign
R7432:Pcdha5 UTSW 18 36962326 missense probably benign 0.07
R7507:Pcdha5 UTSW 18 36960856 missense probably benign 0.01
R7515:Pcdha5 UTSW 18 36962118 missense probably damaging 1.00
R7642:Pcdha5 UTSW 18 36960491 missense probably benign 0.00
R7815:Pcdha5 UTSW 18 36961503 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGATAACGTGCCTGAGATGG -3'
(R):5'- TGACACCGTGAAGATGTGC -3'

Sequencing Primer
(F):5'- GCCTGAGATGGCCATAACCTC -3'
(R):5'- CGTGAAGATGTGCGCACCAG -3'
Posted On2017-06-26