Incidental Mutation 'R5985:Plekha6'
ID481585
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Namepleckstrin homology domain containing, family A member 6
SynonymsPepp3
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133164210-133303435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 133272307 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 208 (R208P)
Ref Sequence ENSEMBL: ENSMUSP00000048214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285] [ENSMUST00000212252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038295
AA Change: R208P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757
AA Change: R208P

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105082
AA Change: R228P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757
AA Change: R228P

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186917
AA Change: R228P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757
AA Change: R228P

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187285
AA Change: R208P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757
AA Change: R208P

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187299
Predicted Effect probably benign
Transcript: ENSMUST00000189598
Predicted Effect unknown
Transcript: ENSMUST00000190186
AA Change: R30P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212142
Predicted Effect probably benign
Transcript: ENSMUST00000212252
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133282165 missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133272336 unclassified probably null
IGL01739:Plekha6 APN 1 133260131 missense probably benign 0.38
IGL01803:Plekha6 APN 1 133272414 nonsense probably null
IGL02053:Plekha6 APN 1 133272492 missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133287849 missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133293861 missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133283293 missense probably benign 0.03
IGL02754:Plekha6 APN 1 133284938 missense probably damaging 0.98
R0100:Plekha6 UTSW 1 133270177 missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133282180 missense probably benign 0.24
R0470:Plekha6 UTSW 1 133272307 missense probably benign 0.07
R1016:Plekha6 UTSW 1 133260094 missense probably benign 0.00
R1254:Plekha6 UTSW 1 133272589 missense probably benign 0.10
R1728:Plekha6 UTSW 1 133287846 missense probably benign
R1729:Plekha6 UTSW 1 133287846 missense probably benign
R1730:Plekha6 UTSW 1 133287846 missense probably benign
R1739:Plekha6 UTSW 1 133287846 missense probably benign
R1762:Plekha6 UTSW 1 133287846 missense probably benign
R1771:Plekha6 UTSW 1 133273913 missense probably benign 0.00
R1783:Plekha6 UTSW 1 133287846 missense probably benign
R1784:Plekha6 UTSW 1 133287846 missense probably benign
R1785:Plekha6 UTSW 1 133287846 missense probably benign
R1786:Plekha6 UTSW 1 133279365 intron probably null
R1997:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R2020:Plekha6 UTSW 1 133284970 missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133279365 intron probably null
R2131:Plekha6 UTSW 1 133279365 intron probably null
R2133:Plekha6 UTSW 1 133279365 intron probably null
R2992:Plekha6 UTSW 1 133294658 missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133294655 missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133273979 missense probably benign
R4067:Plekha6 UTSW 1 133294678 missense probably benign 0.40
R4725:Plekha6 UTSW 1 133283320 missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133280378 missense probably benign 0.01
R5785:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5892:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133260101 missense possibly damaging 0.89
R5986:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133272307 missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133279407 missense probably null 0.96
R6843:Plekha6 UTSW 1 133274878 missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133260055 missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133272535 missense probably benign 0.02
R6970:Plekha6 UTSW 1 133263818 missense probably benign 0.43
R7041:Plekha6 UTSW 1 133272460 missense possibly damaging 0.93
R7248:Plekha6 UTSW 1 133275848 nonsense probably null
R7400:Plekha6 UTSW 1 133274024 nonsense probably null
R7720:Plekha6 UTSW 1 133293707 missense probably damaging 1.00
R7772:Plekha6 UTSW 1 133170022 missense possibly damaging 0.57
R8011:Plekha6 UTSW 1 133263806 missense probably benign
Z1176:Plekha6 UTSW 1 133263813 missense probably benign 0.00
Z1176:Plekha6 UTSW 1 133272471 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCCCAGTTACATCACTGC -3'
(R):5'- GAGCTATACTGCCAGCCATTG -3'

Sequencing Primer
(F):5'- AGTTACATCACTGCCTCTCTG -3'
(R):5'- CCATTGGGCTGAGCAGG -3'
Posted On2017-06-26