Incidental Mutation 'R5985:Prox1'
ID481586
Institutional Source Beutler Lab
Gene Symbol Prox1
Ensembl Gene ENSMUSG00000010175
Gene Nameprospero homeobox 1
SynonymsA230003G05Rik
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5985 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location190118035-190170714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 190146955 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 675 (F675L)
Ref Sequence ENSEMBL: ENSMUSP00000135066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010319] [ENSMUST00000175916] [ENSMUST00000177288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010319
AA Change: F675L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010319
Gene: ENSMUSG00000010175
AA Change: F675L

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175916
AA Change: F675L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135703
Gene: ENSMUSG00000010175
AA Change: F675L

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177288
AA Change: F675L

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135066
Gene: ENSMUSG00000010175
AA Change: F675L

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 579 732 2.2e-86 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality with impaired development of the lens, lymphatic system, liver and pancreas. Heterozygous mutation results in early postnatal lethality with varying penetrance on different genetic backgrounds, obesity and lymphatic vessel abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Prox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prox1 APN 1 190123410 splice site probably benign
IGL01729:Prox1 APN 1 190161175 missense probably benign
IGL02167:Prox1 APN 1 190161280 missense probably benign 0.13
IGL02416:Prox1 APN 1 190161130 missense probably benign 0.00
IGL02419:Prox1 APN 1 190161130 missense probably benign 0.00
IGL03234:Prox1 APN 1 190161636 missense probably damaging 1.00
R0069:Prox1 UTSW 1 190160919 missense possibly damaging 0.85
R0514:Prox1 UTSW 1 190161456 missense probably damaging 0.99
R1249:Prox1 UTSW 1 190147061 missense possibly damaging 0.94
R1299:Prox1 UTSW 1 190146943 splice site probably benign
R1601:Prox1 UTSW 1 190161006 missense probably damaging 0.99
R1893:Prox1 UTSW 1 190160518 splice site probably benign
R2090:Prox1 UTSW 1 190160812 missense probably damaging 0.99
R2366:Prox1 UTSW 1 190161882 missense probably damaging 0.96
R4614:Prox1 UTSW 1 190162008 missense probably damaging 0.99
R4799:Prox1 UTSW 1 190153472 missense probably damaging 0.98
R4873:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R4875:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R5124:Prox1 UTSW 1 190161279 missense possibly damaging 0.73
R5149:Prox1 UTSW 1 190147053 missense possibly damaging 0.89
R5256:Prox1 UTSW 1 190161441 missense probably benign 0.02
R5545:Prox1 UTSW 1 190147142 missense probably damaging 1.00
R5993:Prox1 UTSW 1 190162239 missense probably damaging 1.00
R6833:Prox1 UTSW 1 190160778 missense probably damaging 0.99
R7335:Prox1 UTSW 1 190161845 missense possibly damaging 0.93
R7385:Prox1 UTSW 1 190162126 missense probably benign
R7572:Prox1 UTSW 1 190123386 missense probably benign 0.10
R7608:Prox1 UTSW 1 190153445 missense probably benign 0.24
R7655:Prox1 UTSW 1 190162221 missense probably damaging 0.99
R7656:Prox1 UTSW 1 190162221 missense probably damaging 0.99
Z1088:Prox1 UTSW 1 190161999 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGCTTAAGTAAGAAACCACC -3'
(R):5'- CAGCTCATCAAGTGGTTCAGC -3'

Sequencing Primer
(F):5'- ATTCGGAGTCCTTTCCACAGAGAG -3'
(R):5'- CAAGTGGTTCAGCAATTTCCG -3'
Posted On2017-06-26