Incidental Mutation 'R5985:Ugt2b1'
ID481593
Institutional Source Beutler Lab
Gene Symbol Ugt2b1
Ensembl Gene ENSMUSG00000035836
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B1
Synonyms1300012D20Rik
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86916638-86926530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86919668 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 344 (K344E)
Ref Sequence ENSEMBL: ENSMUSP00000031183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031183
AA Change: K344E

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031183
Gene: ENSMUSG00000035836
AA Change: K344E

DomainStartEndE-ValueType
Pfam:UDPGT 24 527 4.7e-260 PFAM
Pfam:Glyco_tran_28_C 343 454 1.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177553
Meta Mutation Damage Score 0.1302 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the uridine diphosphoglucuronosyltransferase protein family. The encoded enzyme catalyzes the transfer of glucuronic acid from uridine diphosphoglucuronic acid to a diverse array of substrates including steroid hormones and lipid-soluble drugs. This process, known as glucuronidation, is an intermediate step in the metabolism of steroids. Copy number variation in this gene is associated with susceptibility to osteoporosis.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Ugt2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Ugt2b1 APN 5 86925958 missense probably benign 0.05
IGL00556:Ugt2b1 APN 5 86926196 missense probably benign 0.00
IGL02591:Ugt2b1 APN 5 86917704 missense probably damaging 1.00
IGL02795:Ugt2b1 APN 5 86917701 missense probably damaging 1.00
IGL02993:Ugt2b1 APN 5 86921991 missense possibly damaging 0.86
IGL03057:Ugt2b1 APN 5 86926341 missense possibly damaging 0.59
IGL03084:Ugt2b1 APN 5 86926384 missense probably benign 0.00
PIT4531001:Ugt2b1 UTSW 5 86926483 missense probably benign 0.00
R0125:Ugt2b1 UTSW 5 86926102 missense probably benign
R0480:Ugt2b1 UTSW 5 86926456 missense probably benign 0.00
R0551:Ugt2b1 UTSW 5 86926084 missense probably benign 0.01
R0601:Ugt2b1 UTSW 5 86917680 missense possibly damaging 0.53
R0626:Ugt2b1 UTSW 5 86925861 missense probably null 0.13
R1238:Ugt2b1 UTSW 5 86926129 missense probably benign 0.00
R1623:Ugt2b1 UTSW 5 86926408 missense probably benign 0.25
R1919:Ugt2b1 UTSW 5 86926000 missense probably benign 0.00
R1930:Ugt2b1 UTSW 5 86917841 missense probably damaging 1.00
R1931:Ugt2b1 UTSW 5 86917841 missense probably damaging 1.00
R1955:Ugt2b1 UTSW 5 86917713 missense probably damaging 1.00
R3973:Ugt2b1 UTSW 5 86917675 missense probably benign 0.19
R3976:Ugt2b1 UTSW 5 86917675 missense probably benign 0.19
R4115:Ugt2b1 UTSW 5 86926414 missense probably damaging 0.99
R5018:Ugt2b1 UTSW 5 86925962 nonsense probably null
R5043:Ugt2b1 UTSW 5 86917644 missense possibly damaging 0.94
R5765:Ugt2b1 UTSW 5 86919406 missense probably benign 0.32
R5959:Ugt2b1 UTSW 5 86925954 missense probably benign 0.42
R6791:Ugt2b1 UTSW 5 86919257 missense probably damaging 1.00
R7380:Ugt2b1 UTSW 5 86917719 missense not run
R7414:Ugt2b1 UTSW 5 86925834 missense probably damaging 0.97
X0017:Ugt2b1 UTSW 5 86926329 missense probably benign
X0027:Ugt2b1 UTSW 5 86925798 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGCAGTGAGAAGAAGTTTTAC -3'
(R):5'- TGCTCAAGTTATTAGGAAGCCATG -3'

Sequencing Primer
(F):5'- ACTATAGCCCCAAAGCTG -3'
(R):5'- GTCCATCATCTGGATAATGTTC -3'
Posted On2017-06-26