Incidental Mutation 'R5985:Klf15'
ID481596
Institutional Source Beutler Lab
Gene Symbol Klf15
Ensembl Gene ENSMUSG00000030087
Gene NameKruppel-like factor 15
SynonymsKKLF, 1810013I09Rik, CKLF
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location90462576-90475238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90466721 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 93 (G93R)
Ref Sequence ENSEMBL: ENSMUSP00000144808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032174] [ENSMUST00000113530] [ENSMUST00000203039] [ENSMUST00000203607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032174
AA Change: G93R

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032174
Gene: ENSMUSG00000030087
AA Change: G93R

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113530
AA Change: G93R

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109158
Gene: ENSMUSG00000030087
AA Change: G93R

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203039
AA Change: G93R

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144962
Gene: ENSMUSG00000030087
AA Change: G93R

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203607
AA Change: G93R

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144808
Gene: ENSMUSG00000030087
AA Change: G93R

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205136
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display impaired gluconeogenesis with severe fasting induce hypoglycemia. Homozygotes are also more sensitive to induced cardiac stress and display mild cardiac and aortic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Klf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3425:Klf15 UTSW 6 90466820 missense probably benign 0.01
R5443:Klf15 UTSW 6 90467360 missense possibly damaging 0.50
R6171:Klf15 UTSW 6 90466619 missense possibly damaging 0.59
R6529:Klf15 UTSW 6 90467412 missense probably damaging 1.00
R7861:Klf15 UTSW 6 90466838 missense probably benign 0.00
R7944:Klf15 UTSW 6 90466838 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATACCACATGTTGCCCTCG -3'
(R):5'- AGACTCTGGATGAAGGTGGC -3'

Sequencing Primer
(F):5'- GCCCATCTCGGAGGATGACAG -3'
(R):5'- TACAGGTCTCCAGGTCCCTG -3'
Posted On2017-06-26