Incidental Mutation 'R5985:B4galnt3'
ID481597
Institutional Source Beutler Lab
Gene Symbol B4galnt3
Ensembl Gene ENSMUSG00000041372
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 3
Synonyms
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location120203073-120294559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120210158 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 759 (P759S)
Ref Sequence ENSEMBL: ENSMUSP00000148759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057283] [ENSMUST00000212457]
Predicted Effect probably damaging
Transcript: ENSMUST00000057283
AA Change: P760S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058253
Gene: ENSMUSG00000041372
AA Change: P760S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
PA14 129 276 1.16e-21 SMART
low complexity region 591 612 N/A INTRINSIC
Pfam:CHGN 650 985 3.9e-29 PFAM
Pfam:Glyco_transf_7C 896 974 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125341
Predicted Effect probably damaging
Transcript: ENSMUST00000212457
AA Change: P759S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3395 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in B4galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:B4galnt3 APN 6 120215390 missense possibly damaging 0.87
IGL01543:B4galnt3 APN 6 120209312 missense probably benign 0.00
IGL02692:B4galnt3 APN 6 120210311 missense probably damaging 1.00
IGL03149:B4galnt3 APN 6 120231594 splice site probably benign
IGL03272:B4galnt3 APN 6 120216306 missense probably damaging 1.00
Minimus UTSW 6 120215057 missense probably benign
R0121:B4galnt3 UTSW 6 120215038 missense probably benign
R0414:B4galnt3 UTSW 6 120216565 missense probably benign 0.05
R1885:B4galnt3 UTSW 6 120223640 missense probably damaging 0.99
R1908:B4galnt3 UTSW 6 120210090 critical splice donor site probably null
R2264:B4galnt3 UTSW 6 120203810 makesense probably null
R4208:B4galnt3 UTSW 6 120215102 missense probably damaging 0.99
R4353:B4galnt3 UTSW 6 120215476 missense possibly damaging 0.89
R4649:B4galnt3 UTSW 6 120224620 missense probably damaging 1.00
R4874:B4galnt3 UTSW 6 120207206 missense probably damaging 1.00
R5046:B4galnt3 UTSW 6 120214798 missense probably damaging 1.00
R5232:B4galnt3 UTSW 6 120232988 missense probably damaging 1.00
R5431:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R5447:B4galnt3 UTSW 6 120215057 missense probably benign
R5458:B4galnt3 UTSW 6 120210385 missense probably damaging 0.98
R5793:B4galnt3 UTSW 6 120208904 critical splice donor site probably null
R5954:B4galnt3 UTSW 6 120225188 missense possibly damaging 0.88
R6156:B4galnt3 UTSW 6 120214840 missense probably benign 0.02
R6176:B4galnt3 UTSW 6 120224164 missense probably damaging 1.00
R6207:B4galnt3 UTSW 6 120206614 splice site probably null
R6565:B4galnt3 UTSW 6 120217479 nonsense probably null
R7153:B4galnt3 UTSW 6 120214968 missense probably benign 0.00
R7268:B4galnt3 UTSW 6 120215042 missense possibly damaging 0.92
R7307:B4galnt3 UTSW 6 120215431 missense probably benign 0.00
R7311:B4galnt3 UTSW 6 120215435 nonsense probably null
R7360:B4galnt3 UTSW 6 120232979 nonsense probably null
R7538:B4galnt3 UTSW 6 120294423 nonsense probably null
R7674:B4galnt3 UTSW 6 120215205 missense probably benign 0.01
R7706:B4galnt3 UTSW 6 120218952 missense probably benign 0.16
R7727:B4galnt3 UTSW 6 120225187 missense probably benign 0.03
X0028:B4galnt3 UTSW 6 120231552 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCAGCATCAGATCTCAGTTCC -3'
(R):5'- CTTCCTGGAGCTTGAACTGC -3'

Sequencing Primer
(F):5'- AGATCTCAGTTCCACTGTTTGCTAAC -3'
(R):5'- TTGAACTGCTGGATGGCCAAC -3'
Posted On2017-06-26