Incidental Mutation 'R5985:Vmn2r25'
ID481598
Institutional Source Beutler Lab
Gene Symbol Vmn2r25
Ensembl Gene ENSMUSG00000094672
Gene Namevomeronasal 2, receptor 25
SynonymsEG545874
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123822814-123853190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123823628 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 585 (V585A)
Ref Sequence ENSEMBL: ENSMUSP00000124342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162046]
Predicted Effect probably benign
Transcript: ENSMUST00000162046
AA Change: V585A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124342
Gene: ENSMUSG00000094672
AA Change: V585A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 473 6e-31 PFAM
Pfam:NCD3G 519 572 5.8e-25 PFAM
Pfam:7tm_3 603 840 4.8e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Vmn2r25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Vmn2r25 APN 6 123853171 missense probably benign 0.25
IGL01781:Vmn2r25 APN 6 123839365 missense possibly damaging 0.48
IGL01843:Vmn2r25 APN 6 123853003 missense possibly damaging 0.67
IGL02023:Vmn2r25 APN 6 123839429 missense probably damaging 0.96
IGL02502:Vmn2r25 APN 6 123839433 missense probably damaging 0.96
IGL02709:Vmn2r25 APN 6 123839764 missense possibly damaging 0.50
IGL03053:Vmn2r25 APN 6 123823118 missense probably damaging 1.00
PIT4468001:Vmn2r25 UTSW 6 123839598 missense probably benign 0.00
PIT4812001:Vmn2r25 UTSW 6 123823488 missense probably damaging 1.00
R0054:Vmn2r25 UTSW 6 123853025 missense probably benign 0.00
R0312:Vmn2r25 UTSW 6 123828580 splice site probably benign
R0366:Vmn2r25 UTSW 6 123823622 nonsense probably null
R0390:Vmn2r25 UTSW 6 123823181 missense probably damaging 1.00
R0466:Vmn2r25 UTSW 6 123852049 missense probably benign 0.16
R0541:Vmn2r25 UTSW 6 123839827 missense probably damaging 0.97
R0612:Vmn2r25 UTSW 6 123839522 missense probably damaging 1.00
R0865:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R1219:Vmn2r25 UTSW 6 123839323 missense probably benign 0.00
R1240:Vmn2r25 UTSW 6 123851905 missense probably damaging 0.98
R1701:Vmn2r25 UTSW 6 123851795 splice site probably null
R1780:Vmn2r25 UTSW 6 123828465 missense probably damaging 1.00
R1809:Vmn2r25 UTSW 6 123825378 missense probably benign 0.00
R1833:Vmn2r25 UTSW 6 123839684 missense probably benign 0.01
R1964:Vmn2r25 UTSW 6 123823295 missense possibly damaging 0.94
R2154:Vmn2r25 UTSW 6 123839846 missense probably benign 0.01
R2164:Vmn2r25 UTSW 6 123839559 missense possibly damaging 0.96
R3799:Vmn2r25 UTSW 6 123853184 missense probably benign 0.12
R3836:Vmn2r25 UTSW 6 123853085 missense probably damaging 1.00
R3946:Vmn2r25 UTSW 6 123840098 missense probably damaging 0.97
R4282:Vmn2r25 UTSW 6 123823647 missense probably damaging 1.00
R4367:Vmn2r25 UTSW 6 123828537 missense probably damaging 1.00
R4438:Vmn2r25 UTSW 6 123839797 missense probably benign 0.03
R4488:Vmn2r25 UTSW 6 123822860 missense probably damaging 1.00
R4580:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.46
R4631:Vmn2r25 UTSW 6 123853003 missense possibly damaging 0.94
R4765:Vmn2r25 UTSW 6 123823223 missense probably damaging 1.00
R4908:Vmn2r25 UTSW 6 123828447 missense probably benign
R5207:Vmn2r25 UTSW 6 123840103 missense probably damaging 1.00
R5254:Vmn2r25 UTSW 6 123825318 missense probably damaging 1.00
R5444:Vmn2r25 UTSW 6 123828492 missense probably benign 0.00
R5586:Vmn2r25 UTSW 6 123825296 missense probably damaging 1.00
R5607:Vmn2r25 UTSW 6 123828359 missense possibly damaging 0.49
R6046:Vmn2r25 UTSW 6 123822917 missense probably damaging 1.00
R6057:Vmn2r25 UTSW 6 123822941 missense possibly damaging 0.69
R6569:Vmn2r25 UTSW 6 123851982 missense probably benign 0.01
R6826:Vmn2r25 UTSW 6 123823112 missense probably damaging 1.00
R7054:Vmn2r25 UTSW 6 123823610 missense probably damaging 1.00
R7120:Vmn2r25 UTSW 6 123828435 missense possibly damaging 0.51
R7177:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7287:Vmn2r25 UTSW 6 123852081 missense possibly damaging 0.49
R7397:Vmn2r25 UTSW 6 123823539 missense probably damaging 0.96
R7486:Vmn2r25 UTSW 6 123823142 missense probably damaging 1.00
R7699:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7700:Vmn2r25 UTSW 6 123839923 missense possibly damaging 0.94
R7759:Vmn2r25 UTSW 6 123823380 missense probably damaging 0.99
R7802:Vmn2r25 UTSW 6 123851832 missense possibly damaging 0.88
R7850:Vmn2r25 UTSW 6 123828472 missense probably damaging 1.00
R8064:Vmn2r25 UTSW 6 123823622 nonsense probably null
R8170:Vmn2r25 UTSW 6 123853017 missense probably benign 0.09
R8340:Vmn2r25 UTSW 6 123853013 missense probably benign 0.01
R8346:Vmn2r25 UTSW 6 123825391 missense probably benign 0.00
R8395:Vmn2r25 UTSW 6 123823023 missense possibly damaging 0.81
X0020:Vmn2r25 UTSW 6 123839400 missense possibly damaging 0.95
Z1176:Vmn2r25 UTSW 6 123822897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTGACTGTTCTAGGTTGG -3'
(R):5'- CCTTGAGAACTCAACAATTGCTCTG -3'

Sequencing Primer
(F):5'- GTTGGCCAATGAATATTAGTGAGC -3'
(R):5'- TGCTCTGCATAAAATATATGTGCC -3'
Posted On2017-06-26