Incidental Mutation 'R5985:Spns1'
ID481605
Institutional Source Beutler Lab
Gene Symbol Spns1
Ensembl Gene ENSMUSG00000030741
Gene Namespinster homolog 1
Synonyms2210013K02Rik
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126370060-126377450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126376730 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 84 (T84I)
Ref Sequence ENSEMBL: ENSMUSP00000145761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032994] [ENSMUST00000119754] [ENSMUST00000119846] [ENSMUST00000138141] [ENSMUST00000150476] [ENSMUST00000205366] [ENSMUST00000205930]
Predicted Effect probably benign
Transcript: ENSMUST00000032994
AA Change: T84I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032994
Gene: ENSMUSG00000030741
AA Change: T84I

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:Sugar_tr 60 250 4.6e-15 PFAM
Pfam:OATP 60 385 1.5e-9 PFAM
Pfam:MFS_1 65 435 1.8e-34 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119754
AA Change: T84I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112555
Gene: ENSMUSG00000030741
AA Change: T84I

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.2e-8 PFAM
Pfam:Sugar_tr 60 250 1.3e-14 PFAM
Pfam:MFS_1 65 430 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119846
AA Change: T84I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112954
Gene: ENSMUSG00000030741
AA Change: T84I

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.4e-8 PFAM
Pfam:Sugar_tr 60 250 1.5e-14 PFAM
Pfam:MFS_1 65 433 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137263
Predicted Effect probably benign
Transcript: ENSMUST00000138141
AA Change: T84I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117803
Gene: ENSMUSG00000030741
AA Change: T84I

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 151 1.4e-9 PFAM
Pfam:MFS_1 65 149 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150476
AA Change: T54I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115152
Gene: ENSMUSG00000030741
AA Change: T54I

DomainStartEndE-ValueType
Pfam:OATP 28 120 1.3e-8 PFAM
Pfam:Sugar_tr 28 220 1.6e-15 PFAM
Pfam:MFS_1 35 237 2.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152000
Predicted Effect probably benign
Transcript: ENSMUST00000205366
AA Change: T84I

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000205930
AA Change: T68I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206377
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Homozygous mutation results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Spns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Spns1 APN 7 126371242 unclassified probably null
IGL02353:Spns1 APN 7 126375140 missense probably damaging 1.00
IGL02561:Spns1 APN 7 126373769 critical splice donor site probably null
IGL03403:Spns1 APN 7 126371536 splice site probably null
R1634:Spns1 UTSW 7 126371171 unclassified probably benign
R2327:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R3552:Spns1 UTSW 7 126370371 missense possibly damaging 0.94
R3916:Spns1 UTSW 7 126371539 critical splice donor site probably null
R4025:Spns1 UTSW 7 126376946 nonsense probably null
R4095:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R4656:Spns1 UTSW 7 126374302 unclassified probably benign
R4657:Spns1 UTSW 7 126374302 unclassified probably benign
R4697:Spns1 UTSW 7 126377037 missense probably damaging 1.00
R4758:Spns1 UTSW 7 126370794 missense probably damaging 1.00
R5062:Spns1 UTSW 7 126374329 unclassified probably benign
R5371:Spns1 UTSW 7 126373764 unclassified probably benign
R5700:Spns1 UTSW 7 126372469 missense possibly damaging 0.95
R5973:Spns1 UTSW 7 126370323 missense probably damaging 1.00
R6660:Spns1 UTSW 7 126375065 critical splice donor site probably null
R7175:Spns1 UTSW 7 126373789 missense probably damaging 0.98
R8051:Spns1 UTSW 7 126372536 missense probably benign 0.37
Z1177:Spns1 UTSW 7 126372410 critical splice donor site probably null
Z1177:Spns1 UTSW 7 126372411 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAACTAGCTGGCTCCCTCTG -3'
(R):5'- GACCCTCATAGTGGTGGTTCTG -3'

Sequencing Primer
(F):5'- ATGTCCCAGCTCAAGTGGACAG -3'
(R):5'- GTGGTTCTGTGCTACATTAACC -3'
Posted On2017-06-26