Incidental Mutation 'R5985:Herpud1'
ID481610
Institutional Source Beutler Lab
Gene Symbol Herpud1
Ensembl Gene ENSMUSG00000031770
Gene Namehomocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
SynonymsHerp, Mifl
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94386438-94395377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94390794 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 2 (R2Q)
Ref Sequence ENSEMBL: ENSMUSP00000148581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982]
Predicted Effect probably damaging
Transcript: ENSMUST00000034220
AA Change: R125Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770
AA Change: R125Q

DomainStartEndE-ValueType
UBQ 10 86 1.99e-13 SMART
low complexity region 216 242 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161024
Predicted Effect probably benign
Transcript: ENSMUST00000161085
Predicted Effect probably damaging
Transcript: ENSMUST00000161576
AA Change: R126Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770
AA Change: R126Q

DomainStartEndE-ValueType
UBQ 10 87 7.55e-14 SMART
low complexity region 217 243 N/A INTRINSIC
low complexity region 274 291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211982
AA Change: R2Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Herpud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Herpud1 APN 8 94394642 nonsense probably null
R1667:Herpud1 UTSW 8 94389366 missense probably damaging 1.00
R2015:Herpud1 UTSW 8 94392206 missense probably benign 0.44
R2255:Herpud1 UTSW 8 94394613 missense probably benign 0.06
R3707:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R4940:Herpud1 UTSW 8 94390842 missense probably benign 0.18
R4961:Herpud1 UTSW 8 94390826 missense probably benign 0.00
R4981:Herpud1 UTSW 8 94391794 missense probably damaging 1.00
R5214:Herpud1 UTSW 8 94390851 splice site probably null
R5499:Herpud1 UTSW 8 94389413 missense probably damaging 1.00
R5835:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R6702:Herpud1 UTSW 8 94392526 critical splice donor site probably null
R6794:Herpud1 UTSW 8 94394770 intron probably null
R7060:Herpud1 UTSW 8 94390763 missense probably benign 0.04
R7100:Herpud1 UTSW 8 94390847 missense probably damaging 0.98
R7328:Herpud1 UTSW 8 94386620 missense possibly damaging 0.76
R7384:Herpud1 UTSW 8 94389377 missense probably damaging 0.98
R7898:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R7981:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R8025:Herpud1 UTSW 8 94392521 missense probably damaging 1.00
R8036:Herpud1 UTSW 8 94392386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAAGCCACTGGTAGCAAAG -3'
(R):5'- AAGCTAAGGGGCTGTGTACTTTC -3'

Sequencing Primer
(F):5'- GCCACTGGTAGCAAAGTAATTC -3'
(R):5'- CCTCCTGAGTACTGGGATTAAAG -3'
Posted On2017-06-26