Incidental Mutation 'R5985:Rnf144a'
ID481618
Institutional Source Beutler Lab
Gene Symbol Rnf144a
Ensembl Gene ENSMUSG00000020642
Gene Namering finger protein 144A
SynonymsUIP4, Rnf144
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5985 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location26300964-26415254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26317780 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 176 (E176K)
Ref Sequence ENSEMBL: ENSMUSP00000056073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020971] [ENSMUST00000062149] [ENSMUST00000222082]
Predicted Effect probably benign
Transcript: ENSMUST00000020971
AA Change: E176K

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020971
Gene: ENSMUSG00000020642
AA Change: E176K

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062149
AA Change: E176K

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056073
Gene: ENSMUSG00000020642
AA Change: E176K

DomainStartEndE-ValueType
RING 20 68 2.17e-1 SMART
IBR 91 156 6.4e-19 SMART
IBR 168 232 9.16e-1 SMART
RING 185 280 1.58e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222082
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of RING finger domain-containing E3 ubiquitin ligases that also includes parkin and parc. The expression of this gene is induced by DNA damage. The encoded protein interacts with the cytoplasmic DNA-dependent protein kinase, catalytic subunit (DNA-PKcs) and promotes its degradation through ubiquitination. The orthologous mouse protein has been shown to interact with a ubiquitin-conjugating enzyme involved in embryonic development. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,820,324 Y643N probably damaging Het
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in Rnf144a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Rnf144a APN 12 26327301 missense probably benign 0.01
IGL02709:Rnf144a APN 12 26321010 missense probably damaging 1.00
R0432:Rnf144a UTSW 12 26339329 missense probably damaging 1.00
R3897:Rnf144a UTSW 12 26310713 missense probably damaging 1.00
R4087:Rnf144a UTSW 12 26327592 missense probably damaging 1.00
R4504:Rnf144a UTSW 12 26327303 missense probably benign 0.11
R6392:Rnf144a UTSW 12 26310780 missense possibly damaging 0.93
R7827:Rnf144a UTSW 12 26339440 start codon destroyed probably null 0.89
R8431:Rnf144a UTSW 12 26327301 missense probably damaging 1.00
RF018:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314008 critical splice donor site probably benign
RF036:Rnf144a UTSW 12 26314013 critical splice donor site probably benign
RF043:Rnf144a UTSW 12 26314014 critical splice donor site probably benign
RF048:Rnf144a UTSW 12 26314011 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTCATGTCTGCCATTCG -3'
(R):5'- AAATTTAGGTATGTGCTGACGTTGC -3'

Sequencing Primer
(F):5'- GAGGTTGCATAGTACTCACATCCAG -3'
(R):5'- GTTTTGCCTTAATCTAGCAGAATCAC -3'
Posted On2017-06-26