Mutagenetix > Incidental Mutations

Incidental Mutation 'R5985:Adgrf1'

481626

Institutional Source

Beutler Lab

Gene Symbol

Adgrf1

Ensembl Gene

ENSMUSG00000041293

Gene Name

adhesion G protein-coupled receptor F1

Synonyms

Gpr110, 5031409J19Rik

MMRRC Submission

044165-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5985 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43270329-43324737 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43293255 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 34 (I34T)

Ref Sequence

ENSEMBL: ENSMUSP00000049380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047399]

Predicted Effect

probably benign
Transcript: ENSMUST00000047399
AA Change: I34T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000049380
Gene: ENSMUSG00000041293
AA Change: I34T

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	59	83	N/A	INTRINSIC
Pfam:SEA	150	238	3.7e-10	PFAM
low complexity region	341	363	N/A	INTRINSIC
GPS	528	576	5.56e-15	SMART
Pfam:7tm_2	580	832	2.1e-38	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 93.2%

Validation Efficiency

96% (47/49)

MGI Phenotype

PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	T	19: 45,820,324	Y643N	probably damaging	Het
Abca13	A	C	11: 9,291,628	I1164L	probably benign	Het
Actn1	C	A	12: 80,168,395	G864V	probably damaging	Het
Ankrd10	T	A	8: 11,619,077	K225*	probably null	Het
Ankrd29	G	A	18: 12,279,775	A115V	probably damaging	Het
Atg2a	A	G	19: 6,254,637	T1175A	probably damaging	Het
Atp12a	A	G	14: 56,384,341	D781G	probably damaging	Het
B4galnt3	G	A	6: 120,210,158	P759S	probably damaging	Het
Card10	T	C	15: 78,791,211	I448V	probably benign	Het
Col15a1	T	C	4: 47,284,507	F821L	probably damaging	Het
Cpeb3	T	C	19: 37,087,552	Y498C	probably damaging	Het
Defb37	A	T	8: 18,986,331	C58S	probably damaging	Het
Faap20	T	C	4: 155,250,340		probably benign	Het
Frem1	C	T	4: 82,966,050	V1204I	probably benign	Het
Gal3st2	T	C	1: 93,873,613	V46A	possibly damaging	Het
Gan	C	T	8: 117,195,818	S430L	possibly damaging	Het
Gas2	T	A	7: 51,943,676	I168K	probably damaging	Het
Gli3	A	G	13: 15,723,555	D740G	probably damaging	Het
Gm15922	C	A	7: 3,737,317	G302C	probably damaging	Het
Gm3898	G	A	9: 43,830,032		noncoding transcript	Het
Gria4	T	C	9: 4,503,593	Q341R	probably damaging	Het
Herpud1	G	A	8: 94,390,794	R2Q	probably damaging	Het
Klf15	G	A	6: 90,466,721	G93R	possibly damaging	Het
Mtmr7	A	G	8: 40,551,832	F568L	probably benign	Het
Myod1	A	G	7: 46,377,798	Y229C	probably damaging	Het
Olfr1150-ps1	A	G	2: 87,357,605	I54V	probably benign	Het
Olfr1156	A	G	2: 87,949,321	M304T	probably benign	Het
Phf11b	A	G	14: 59,321,578	L235P	possibly damaging	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Prox1	A	T	1: 190,146,955	F675L	possibly damaging	Het
Rnf144a	C	T	12: 26,317,780	E176K	probably benign	Het
Safb2	T	C	17: 56,563,181	E965G	possibly damaging	Het
Sik3	A	G	9: 46,211,675	N874S	probably damaging	Het
Slitrk3	T	C	3: 73,050,900	I180V	probably damaging	Het
Speg	T	C	1: 75,406,684	V1141A	possibly damaging	Het
Spns1	G	A	7: 126,376,730	T84I	probably benign	Het
Syne2	C	G	12: 75,966,159	P2709R	probably damaging	Het
Terb1	A	T	8: 104,451,807	S662T	probably benign	Het
Terb1	A	G	8: 104,482,316	S377P	probably damaging	Het
Tph1	A	G	7: 46,653,781	Y258H	probably damaging	Het
Trip12	T	A	1: 84,725,771	E1881D	probably damaging	Het
Trpc7	A	G	13: 56,810,545	L412P	probably damaging	Het
Ttll13	C	T	7: 80,254,638	A337V	probably damaging	Het
Ugt2b1	T	C	5: 86,919,668	K344E	possibly damaging	Het
Vmn1r36	T	A	6: 66,716,871	I7F	probably benign	Het
Vmn2r14	A	T	5: 109,220,216	N303K	possibly damaging	Het
Vmn2r25	A	G	6: 123,823,628	V585A	probably benign	Het
Zan	A	C	5: 137,446,037		probably null	Het
Zfp423	A	T	8: 87,782,146	N502K	possibly damaging	Het
Zfp473	C	T	7: 44,733,328	R526Q	probably damaging	Het

Other mutations in Adgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Adgrf1	APN	17	43313195	missense	probably null	0.92
IGL01359:Adgrf1	APN	17	43310686	missense	probably damaging	0.99
IGL02131:Adgrf1	APN	17	43303747	missense	probably damaging	0.99
IGL02692:Adgrf1	APN	17	43303778	missense	probably damaging	1.00
IGL02891:Adgrf1	APN	17	43311161	missense	probably damaging	0.96
IGL03027:Adgrf1	APN	17	43296714	missense	probably damaging	1.00
IGL03296:Adgrf1	APN	17	43321153	splice site	probably benign
R0211:Adgrf1	UTSW	17	43296690	missense	probably damaging	1.00
R0211:Adgrf1	UTSW	17	43296690	missense	probably damaging	1.00
R0389:Adgrf1	UTSW	17	43303788	critical splice donor site	probably null
R0488:Adgrf1	UTSW	17	43310411	missense	probably damaging	0.99
R1591:Adgrf1	UTSW	17	43310981	missense	probably damaging	1.00
R1817:Adgrf1	UTSW	17	43310033	missense	probably benign	0.01
R1819:Adgrf1	UTSW	17	43310033	missense	probably benign	0.01
R2009:Adgrf1	UTSW	17	43321221	nonsense	probably null
R2032:Adgrf1	UTSW	17	43311275	missense	probably damaging	1.00
R2140:Adgrf1	UTSW	17	43300802	missense	probably damaging	0.99
R3953:Adgrf1	UTSW	17	43310207	missense	probably benign	0.08
R4679:Adgrf1	UTSW	17	43310493	missense	probably damaging	1.00
R4775:Adgrf1	UTSW	17	43311163	missense	probably damaging	1.00
R4858:Adgrf1	UTSW	17	43303672	missense	probably damaging	1.00
R4894:Adgrf1	UTSW	17	43299084	nonsense	probably null
R4895:Adgrf1	UTSW	17	43310620	missense	probably benign	0.33
R4935:Adgrf1	UTSW	17	43295239	missense	probably benign	0.00
R5027:Adgrf1	UTSW	17	43303747	missense	probably damaging	0.99
R5373:Adgrf1	UTSW	17	43291005	start gained	probably benign
R5374:Adgrf1	UTSW	17	43291005	start gained	probably benign
R5455:Adgrf1	UTSW	17	43321143	splice site	probably null
R5579:Adgrf1	UTSW	17	43311064	missense	probably damaging	1.00
R6038:Adgrf1	UTSW	17	43295209	missense	probably benign	0.00
R6038:Adgrf1	UTSW	17	43295209	missense	probably benign	0.00
R6160:Adgrf1	UTSW	17	43310687	missense	probably damaging	1.00
R6227:Adgrf1	UTSW	17	43310273	missense	probably benign	0.05
R6500:Adgrf1	UTSW	17	43310372	missense	probably damaging	1.00
R7066:Adgrf1	UTSW	17	43310260	missense	probably benign	0.05
R7099:Adgrf1	UTSW	17	43310602	missense	probably benign	0.00
R7561:Adgrf1	UTSW	17	43311109	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGCACTTGCACCTGCTGTTC -3'
(R):5'- AATCCTCAGAAGTGTCTTGCTCTTAAG -3'

Sequencing Primer
(F):5'- TGCAGGCACCTTCAGTTG -3'
(R):5'- AGAAGTGTCTTGCTCTTAAGAATTAC -3'

Posted On

2017-06-26