Incidental Mutation 'R5985:9130011E15Rik'
ID481630
Institutional Source Beutler Lab
Gene Symbol 9130011E15Rik
Ensembl Gene ENSMUSG00000039901
Gene NameRIKEN cDNA 9130011E15 gene
Synonyms
MMRRC Submission 044165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5985 (G1)
Quality Score187.009
Status Validated
Chromosome19
Chromosomal Location45818144-45998488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45820324 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 643 (Y643N)
Ref Sequence ENSEMBL: ENSMUSP00000048454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026247] [ENSMUST00000045396] [ENSMUST00000079431] [ENSMUST00000161886] [ENSMUST00000162528] [ENSMUST00000162661]
Predicted Effect probably benign
Transcript: ENSMUST00000026247
SMART Domains Protein: ENSMUSP00000026247
Gene: ENSMUSG00000025221

DomainStartEndE-ValueType
EFh 126 154 1e-1 SMART
EFh 162 190 1.88e-6 SMART
EFh 210 238 4.6e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000045396
AA Change: Y643N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048454
Gene: ENSMUSG00000039901
AA Change: Y643N

DomainStartEndE-ValueType
low complexity region 155 167 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
DUF1741 435 671 5.65e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079431
SMART Domains Protein: ENSMUSP00000078400
Gene: ENSMUSG00000025221

DomainStartEndE-ValueType
EFh 126 154 1e-1 SMART
EFh 162 190 1.88e-6 SMART
EFh 210 238 4.6e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111906
Predicted Effect probably benign
Transcript: ENSMUST00000161886
SMART Domains Protein: ENSMUSP00000124482
Gene: ENSMUSG00000025221

DomainStartEndE-ValueType
EFh 94 122 1e-1 SMART
EFh 130 158 1.88e-6 SMART
EFh 178 206 4.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162528
SMART Domains Protein: ENSMUSP00000125142
Gene: ENSMUSG00000025221

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
EFh 144 172 1e-1 SMART
EFh 180 208 1.88e-6 SMART
EFh 228 256 4.6e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162661
SMART Domains Protein: ENSMUSP00000124821
Gene: ENSMUSG00000025221

DomainStartEndE-ValueType
EFh 94 122 3.4e-4 SMART
EFh 142 170 1.63e-1 SMART
Meta Mutation Damage Score 0.4973 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,291,628 I1164L probably benign Het
Actn1 C A 12: 80,168,395 G864V probably damaging Het
Adgrf1 T C 17: 43,293,255 I34T probably benign Het
Ankrd10 T A 8: 11,619,077 K225* probably null Het
Ankrd29 G A 18: 12,279,775 A115V probably damaging Het
Atg2a A G 19: 6,254,637 T1175A probably damaging Het
Atp12a A G 14: 56,384,341 D781G probably damaging Het
B4galnt3 G A 6: 120,210,158 P759S probably damaging Het
Card10 T C 15: 78,791,211 I448V probably benign Het
Col15a1 T C 4: 47,284,507 F821L probably damaging Het
Cpeb3 T C 19: 37,087,552 Y498C probably damaging Het
Defb37 A T 8: 18,986,331 C58S probably damaging Het
Faap20 T C 4: 155,250,340 probably benign Het
Frem1 C T 4: 82,966,050 V1204I probably benign Het
Gal3st2 T C 1: 93,873,613 V46A possibly damaging Het
Gan C T 8: 117,195,818 S430L possibly damaging Het
Gas2 T A 7: 51,943,676 I168K probably damaging Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm15922 C A 7: 3,737,317 G302C probably damaging Het
Gm3898 G A 9: 43,830,032 noncoding transcript Het
Gria4 T C 9: 4,503,593 Q341R probably damaging Het
Herpud1 G A 8: 94,390,794 R2Q probably damaging Het
Klf15 G A 6: 90,466,721 G93R possibly damaging Het
Mtmr7 A G 8: 40,551,832 F568L probably benign Het
Myod1 A G 7: 46,377,798 Y229C probably damaging Het
Olfr1150-ps1 A G 2: 87,357,605 I54V probably benign Het
Olfr1156 A G 2: 87,949,321 M304T probably benign Het
Phf11b A G 14: 59,321,578 L235P possibly damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Prox1 A T 1: 190,146,955 F675L possibly damaging Het
Rnf144a C T 12: 26,317,780 E176K probably benign Het
Safb2 T C 17: 56,563,181 E965G possibly damaging Het
Sik3 A G 9: 46,211,675 N874S probably damaging Het
Slitrk3 T C 3: 73,050,900 I180V probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Spns1 G A 7: 126,376,730 T84I probably benign Het
Syne2 C G 12: 75,966,159 P2709R probably damaging Het
Terb1 A T 8: 104,451,807 S662T probably benign Het
Terb1 A G 8: 104,482,316 S377P probably damaging Het
Tph1 A G 7: 46,653,781 Y258H probably damaging Het
Trip12 T A 1: 84,725,771 E1881D probably damaging Het
Trpc7 A G 13: 56,810,545 L412P probably damaging Het
Ttll13 C T 7: 80,254,638 A337V probably damaging Het
Ugt2b1 T C 5: 86,919,668 K344E possibly damaging Het
Vmn1r36 T A 6: 66,716,871 I7F probably benign Het
Vmn2r14 A T 5: 109,220,216 N303K possibly damaging Het
Vmn2r25 A G 6: 123,823,628 V585A probably benign Het
Zan A C 5: 137,446,037 probably null Het
Zfp423 A T 8: 87,782,146 N502K possibly damaging Het
Zfp473 C T 7: 44,733,328 R526Q probably damaging Het
Other mutations in 9130011E15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:9130011E15Rik APN 19 45940488 missense probably benign 0.19
IGL00788:9130011E15Rik APN 19 45932350 critical splice donor site probably null
IGL01356:9130011E15Rik APN 19 45966303 missense possibly damaging 0.94
IGL01477:9130011E15Rik APN 19 45978604 missense probably damaging 0.99
IGL01660:9130011E15Rik APN 19 45940476 missense probably damaging 1.00
IGL02193:9130011E15Rik APN 19 45972884 missense probably benign 0.02
IGL02863:9130011E15Rik APN 19 45958411 missense probably damaging 1.00
IGL03108:9130011E15Rik APN 19 45820353 missense probably damaging 0.99
R0035:9130011E15Rik UTSW 19 45891240 missense probably damaging 1.00
R0791:9130011E15Rik UTSW 19 45933868 splice site probably null
R0792:9130011E15Rik UTSW 19 45933868 splice site probably null
R1487:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R1843:9130011E15Rik UTSW 19 45975252 missense probably benign 0.17
R2061:9130011E15Rik UTSW 19 45978667 missense probably damaging 1.00
R2070:9130011E15Rik UTSW 19 45891285 missense probably damaging 1.00
R2072:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2073:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2074:9130011E15Rik UTSW 19 45965381 missense probably damaging 0.99
R2091:9130011E15Rik UTSW 19 45952680 missense probably damaging 1.00
R2263:9130011E15Rik UTSW 19 45932349 critical splice donor site probably null
R2863:9130011E15Rik UTSW 19 45885957 missense probably damaging 1.00
R3236:9130011E15Rik UTSW 19 45975283 splice site probably benign
R3796:9130011E15Rik UTSW 19 45921610 splice site probably benign
R4044:9130011E15Rik UTSW 19 45820324 missense probably damaging 1.00
R4716:9130011E15Rik UTSW 19 45960342 missense probably damaging 1.00
R4974:9130011E15Rik UTSW 19 45820287 missense probably damaging 1.00
R4983:9130011E15Rik UTSW 19 45950707 missense probably benign
R5063:9130011E15Rik UTSW 19 45885955 missense possibly damaging 0.95
R5313:9130011E15Rik UTSW 19 45818975 missense probably damaging 1.00
R5782:9130011E15Rik UTSW 19 45886027 missense probably benign 0.08
R6220:9130011E15Rik UTSW 19 45846115 missense possibly damaging 0.79
R6379:9130011E15Rik UTSW 19 45921697 missense possibly damaging 0.46
R6674:9130011E15Rik UTSW 19 45974998 missense probably benign 0.06
R6842:9130011E15Rik UTSW 19 45818977 missense probably benign 0.05
R6890:9130011E15Rik UTSW 19 45960357 missense probably damaging 1.00
R7034:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7036:9130011E15Rik UTSW 19 45965249 missense probably damaging 0.98
R7305:9130011E15Rik UTSW 19 45892121 missense probably benign 0.35
R7411:9130011E15Rik UTSW 19 45965435 missense probably benign 0.00
R7762:9130011E15Rik UTSW 19 45940443 critical splice donor site probably null
R8021:9130011E15Rik UTSW 19 45956741 critical splice acceptor site probably null
X0060:9130011E15Rik UTSW 19 45932393 missense possibly damaging 0.95
Z1088:9130011E15Rik UTSW 19 45818905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACTGCTTTGACAGAAAGGC -3'
(R):5'- AAGCGTACACTGGCGGTATC -3'

Sequencing Primer
(F):5'- CTGCATAGCAAGCCCCTGTAG -3'
(R):5'- CCTATAATATCAGCACTTGGGAGGC -3'
Posted On2017-06-26