Incidental Mutation 'R5986:Agl'
ID481635
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116772496 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 992 (F992I)
Ref Sequence ENSEMBL: ENSMUSP00000143582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably damaging
Transcript: ENSMUST00000040603
AA Change: F992I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: F992I

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159742
AA Change: F992I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: F992I

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160484
AA Change: F327I
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400
AA Change: F327I

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162792
AA Change: F992I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: F992I

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
X0065:Agl UTSW 3 116781330 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGTCTGTGATAGTTCCTCAG -3'
(R):5'- AGATAAGTCACAGCTTCCTCAGG -3'

Sequencing Primer
(F):5'- CAGGTTTTGGTCTTTTACAATCATG -3'
(R):5'- ACAGCTTCCTCAGGCCAGTTTC -3'
Posted On2017-06-26