Incidental Mutation 'R5986:Ptbp3'
ID481638
Institutional Source Beutler Lab
Gene Symbol Ptbp3
Ensembl Gene ENSMUSG00000028382
Gene Namepolypyrimidine tract binding protein 3
SynonymsRod1, 5830471K22Rik
MMRRC Submission 044166-MU
Accession Numbers

Genbank: NM_144904; MGI: 1923334; Ensembl: ENSMUST00000030076

Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location59471868-59549364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59493311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 123 (D123G)
Ref Sequence ENSEMBL: ENSMUSP00000133996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030076] [ENSMUST00000102883] [ENSMUST00000134879] [ENSMUST00000148331] [ENSMUST00000172471] [ENSMUST00000172768] [ENSMUST00000173699] [ENSMUST00000173884] [ENSMUST00000174586] [ENSMUST00000174748]
Predicted Effect probably benign
Transcript: ENSMUST00000030076
AA Change: D225G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030076
Gene: ENSMUSG00000028382
AA Change: D225G

DomainStartEndE-ValueType
RRM 31 100 2.24e-3 SMART
low complexity region 115 130 N/A INTRINSIC
RRM 154 223 2.51e-6 SMART
low complexity region 277 293 N/A INTRINSIC
RRM 330 399 2.13e-9 SMART
RRM 447 517 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102883
AA Change: D253G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099947
Gene: ENSMUSG00000028382
AA Change: D253G

DomainStartEndE-ValueType
RRM 59 128 2.24e-3 SMART
low complexity region 143 158 N/A INTRINSIC
RRM 182 251 2.51e-6 SMART
low complexity region 305 321 N/A INTRINSIC
RRM 358 427 2.13e-9 SMART
RRM 475 545 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134879
Predicted Effect probably benign
Transcript: ENSMUST00000148331
AA Change: D222G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122840
Gene: ENSMUSG00000028382
AA Change: D222G

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172471
SMART Domains Protein: ENSMUSP00000133886
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
PDB:1SJR|A 1 34 2e-11 PDB
Blast:RRM_2 1 37 6e-9 BLAST
low complexity region 44 64 N/A INTRINSIC
RRM 92 161 2.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172768
AA Change: D222G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134102
Gene: ENSMUSG00000028382
AA Change: D222G

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173699
AA Change: D159G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134290
Gene: ENSMUSG00000028382
AA Change: D159G

DomainStartEndE-ValueType
PDB:2CQ1|A 2 44 7e-18 PDB
low complexity region 49 64 N/A INTRINSIC
RRM 88 157 2.51e-6 SMART
low complexity region 211 227 N/A INTRINSIC
RRM 264 333 2.13e-9 SMART
RRM 381 451 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173884
AA Change: D123G

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133996
Gene: ENSMUSG00000028382
AA Change: D123G

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
RRM 52 121 2.51e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174586
AA Change: D256G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133612
Gene: ENSMUSG00000028382
AA Change: D256G

DomainStartEndE-ValueType
RRM 62 131 2.24e-3 SMART
low complexity region 146 161 N/A INTRINSIC
RRM 185 254 2.51e-6 SMART
low complexity region 308 324 N/A INTRINSIC
RRM 361 430 2.13e-9 SMART
RRM 478 548 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174748
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Ptbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Ptbp3 APN 4 59477228 missense probably benign 0.29
IGL03035:Ptbp3 APN 4 59477218 missense probably benign 0.00
IGL03118:Ptbp3 APN 4 59501470 missense probably benign 0.03
IGL03257:Ptbp3 APN 4 59493370 splice site probably benign
IGL03279:Ptbp3 APN 4 59476937 missense possibly damaging 0.68
R0557:Ptbp3 UTSW 4 59517684 nonsense probably null
R1741:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R1914:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R1915:Ptbp3 UTSW 4 59517635 missense probably damaging 1.00
R2679:Ptbp3 UTSW 4 59494615 splice site probably benign
R3798:Ptbp3 UTSW 4 59546166 missense probably benign 0.05
R4793:Ptbp3 UTSW 4 59514297 missense possibly damaging 0.71
R4869:Ptbp3 UTSW 4 59524443 missense possibly damaging 0.79
R5573:Ptbp3 UTSW 4 59485626 missense probably damaging 1.00
R6350:Ptbp3 UTSW 4 59482624 missense probably damaging 0.98
R6659:Ptbp3 UTSW 4 59517640 missense probably damaging 1.00
R7283:Ptbp3 UTSW 4 59514384 missense probably benign 0.00
R7523:Ptbp3 UTSW 4 59546159 missense probably benign
R7566:Ptbp3 UTSW 4 59514280 missense probably benign 0.03
YA93:Ptbp3 UTSW 4 59524413 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGACTAAGGGAACTACCACCTC -3'
(R):5'- GTCAGAGAATAAGTAAGCCTAGCTC -3'

Sequencing Primer
(F):5'- GGGAACTACCACCTCATATTAAGG -3'
(R):5'- AAGTAAGCCTAGCTCTTTGCAC -3'
Posted On2017-06-26