Incidental Mutation 'R5986:Gm13128'
ID481641
Institutional Source Beutler Lab
Gene Symbol Gm13128
Ensembl Gene ENSMUSG00000078508
Gene Namepredicted gene 13128
Synonyms
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5986 (G1)
Quality Score143.008
Status Not validated
Chromosome4
Chromosomal Location144330249-144333465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144332753 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 345 (V345F)
Ref Sequence ENSEMBL: ENSMUSP00000101377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105751]
Predicted Effect probably damaging
Transcript: ENSMUST00000105751
AA Change: V345F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101377
Gene: ENSMUSG00000078508
AA Change: V345F

DomainStartEndE-ValueType
low complexity region 188 200 N/A INTRINSIC
SCOP:d1a4ya_ 205 408 6e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Gm13128
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0097:Gm13128 UTSW 4 144331287 missense probably benign 0.01
R1743:Gm13128 UTSW 4 144333005 missense probably benign 0.03
R3079:Gm13128 UTSW 4 144331528 missense probably damaging 1.00
R3948:Gm13128 UTSW 4 144331306 missense probably benign 0.01
R3954:Gm13128 UTSW 4 144331668 missense probably benign 0.03
R4448:Gm13128 UTSW 4 144332685 missense probably damaging 1.00
R5008:Gm13128 UTSW 4 144331266 missense probably benign 0.02
R5715:Gm13128 UTSW 4 144331300 missense possibly damaging 0.67
R6008:Gm13128 UTSW 4 144331207 missense probably benign 0.08
R6278:Gm13128 UTSW 4 144330267 missense probably damaging 0.98
R6383:Gm13128 UTSW 4 144333147 makesense probably null
R6523:Gm13128 UTSW 4 144331648 missense probably benign 0.42
R6747:Gm13128 UTSW 4 144332978 missense probably benign 0.00
R7276:Gm13128 UTSW 4 144332646 missense possibly damaging 0.67
R7555:Gm13128 UTSW 4 144332741 missense probably benign 0.01
R8213:Gm13128 UTSW 4 144330460 missense probably benign 0.03
Z1177:Gm13128 UTSW 4 144331193 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGACCCCAACCATGTGATC -3'
(R):5'- GTACAGTTCCATGGTCAGCTG -3'

Sequencing Primer
(F):5'- AACCATGTGATCTCTCCCTAGGTG -3'
(R):5'- TCCATGGTCAGCTGGCTCATG -3'
Posted On2017-06-26