Incidental Mutation 'R5986:Ankib1'
ID481643
Institutional Source Beutler Lab
Gene Symbol Ankib1
Ensembl Gene ENSMUSG00000040351
Gene Nameankyrin repeat and IBR domain containing 1
Synonyms2310061P20Rik, 4631416I11Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3690000-3802925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3747071 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 247 (D247G)
Ref Sequence ENSEMBL: ENSMUSP00000142687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043551] [ENSMUST00000200335]
Predicted Effect probably damaging
Transcript: ENSMUST00000043551
AA Change: D247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040946
Gene: ENSMUSG00000040351
AA Change: D247G

DomainStartEndE-ValueType
ANK 45 75 7.08e-1 SMART
ANK 145 174 2.32e-5 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 9.73e-2 SMART
IBR 403 479 8.72e-12 SMART
IBR 502 566 2.59e-5 SMART
RING 520 644 2.36e0 SMART
low complexity region 764 773 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
UIM 846 865 3.62e-1 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199763
Predicted Effect probably damaging
Transcript: ENSMUST00000200335
AA Change: D247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142687
Gene: ENSMUSG00000040351
AA Change: D247G

DomainStartEndE-ValueType
ANK 45 75 4.5e-3 SMART
ANK 145 174 1.4e-7 SMART
low complexity region 209 219 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
RING 334 382 4.6e-4 SMART
IBR 403 479 2.9e-14 SMART
IBR 502 566 8.3e-8 SMART
RING 520 644 1.1e-2 SMART
low complexity region 768 779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Ankib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Ankib1 APN 5 3727573 missense probably benign 0.20
IGL01329:Ankib1 APN 5 3734194 splice site probably benign
IGL01372:Ankib1 APN 5 3772594 missense probably damaging 1.00
IGL01593:Ankib1 APN 5 3732590 missense probably benign 0.00
IGL01613:Ankib1 APN 5 3713146 nonsense probably null
IGL01728:Ankib1 APN 5 3701992 splice site probably benign
IGL01782:Ankib1 APN 5 3727607 missense probably damaging 1.00
IGL01878:Ankib1 APN 5 3734152 missense possibly damaging 0.69
IGL02730:Ankib1 APN 5 3702995 missense probably damaging 1.00
IGL02742:Ankib1 APN 5 3693479 missense probably benign 0.04
IGL02873:Ankib1 APN 5 3772619 missense probably damaging 1.00
R0033:Ankib1 UTSW 5 3769588 missense possibly damaging 0.52
R0242:Ankib1 UTSW 5 3700344 splice site probably benign
R0564:Ankib1 UTSW 5 3729655 missense probably damaging 0.99
R0632:Ankib1 UTSW 5 3772529 missense probably benign 0.02
R0732:Ankib1 UTSW 5 3713163 missense possibly damaging 0.89
R1678:Ankib1 UTSW 5 3706301 missense probably damaging 0.99
R1816:Ankib1 UTSW 5 3734028 missense probably benign 0.05
R2165:Ankib1 UTSW 5 3713210 missense possibly damaging 0.69
R3434:Ankib1 UTSW 5 3692760 missense probably damaging 1.00
R3749:Ankib1 UTSW 5 3734097 missense probably damaging 0.98
R4745:Ankib1 UTSW 5 3732566 missense probably damaging 1.00
R4827:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R4983:Ankib1 UTSW 5 3769652 missense probably benign 0.09
R4989:Ankib1 UTSW 5 3713217 missense probably damaging 0.99
R5022:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5057:Ankib1 UTSW 5 3734011 missense possibly damaging 0.96
R5510:Ankib1 UTSW 5 3729693 missense probably benign 0.02
R5606:Ankib1 UTSW 5 3701907 missense probably damaging 1.00
R5910:Ankib1 UTSW 5 3693217 missense probably benign
R5929:Ankib1 UTSW 5 3769633 missense possibly damaging 0.86
R6281:Ankib1 UTSW 5 3701965 missense possibly damaging 0.70
R6336:Ankib1 UTSW 5 3700377 nonsense probably null
R6377:Ankib1 UTSW 5 3693855 missense possibly damaging 0.78
R7001:Ankib1 UTSW 5 3694781 missense probably benign
R7264:Ankib1 UTSW 5 3755739 missense probably damaging 1.00
R7380:Ankib1 UTSW 5 3722576 missense probably benign 0.03
R7402:Ankib1 UTSW 5 3769586 missense probably benign 0.01
R7491:Ankib1 UTSW 5 3701911 missense probably damaging 1.00
R7525:Ankib1 UTSW 5 3755734 missense possibly damaging 0.95
R7562:Ankib1 UTSW 5 3747021 missense probably null 1.00
R8116:Ankib1 UTSW 5 3702995 missense probably damaging 1.00
R8347:Ankib1 UTSW 5 3747065 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713136 missense probably damaging 1.00
Z1088:Ankib1 UTSW 5 3713137 nonsense probably null
Z1176:Ankib1 UTSW 5 3692763 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATTTACAGCCACTGCATGC -3'
(R):5'- GAGTCCACTCACATCTGCAC -3'

Sequencing Primer
(F):5'- AACATGTGCACAGAAATTATGTAGGC -3'
(R):5'- CTGCACACAACCTGGGATGTTAAG -3'
Posted On2017-06-26