Incidental Mutation 'R5986:Bccip'
ID481652
Institutional Source Beutler Lab
Gene Symbol Bccip
Ensembl Gene ENSMUSG00000030983
Gene NameBRCA2 and CDKN1A interacting protein
SynonymsTOK-1, 1110013J05Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location133709333-133721145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133720865 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 313 (H313Q)
Ref Sequence ENSEMBL: ENSMUSP00000033282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033282] [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
Predicted Effect probably benign
Transcript: ENSMUST00000033282
AA Change: H313Q

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033282
Gene: ENSMUSG00000030983
AA Change: H313Q

DomainStartEndE-ValueType
Pfam:BCIP 58 258 2.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033290
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063669
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106139
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151711
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Bccip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Bccip APN 7 133709376 missense probably benign 0.20
IGL03345:Bccip APN 7 133709491 missense probably benign
R0071:Bccip UTSW 7 133714231 missense probably damaging 1.00
R0071:Bccip UTSW 7 133714231 missense probably damaging 1.00
R0514:Bccip UTSW 7 133719130 missense possibly damaging 0.80
R2171:Bccip UTSW 7 133719114 missense probably benign 0.09
R4435:Bccip UTSW 7 133719213 missense probably benign 0.00
R4626:Bccip UTSW 7 133720728 missense possibly damaging 0.92
R4648:Bccip UTSW 7 133714899 missense probably damaging 1.00
R5055:Bccip UTSW 7 133714923 missense probably benign 0.13
R5658:Bccip UTSW 7 133717620 missense possibly damaging 0.58
R6328:Bccip UTSW 7 133717774 missense probably damaging 0.97
R6818:Bccip UTSW 7 133717759 missense probably damaging 1.00
R6934:Bccip UTSW 7 133720791 missense probably benign 0.00
R8301:Bccip UTSW 7 133719204 missense probably benign 0.00
R8427:Bccip UTSW 7 133709491 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTGCTACAGAAGGCAATCTTG -3'
(R):5'- GCCCTGGACATGAACACTTC -3'

Sequencing Primer
(F):5'- GCAATCTTGAAGTTCAGCTACTCGG -3'
(R):5'- CCTGGACATGAACACTTCAAGTATG -3'
Posted On2017-06-26