Incidental Mutation 'R5986:Rassf1'
ID481658
Institutional Source Beutler Lab
Gene Symbol Rassf1
Ensembl Gene ENSMUSG00000010067
Gene NameRas association (RalGDS/AF-6) domain family member 1
Synonyms123F protein, NORE2A, Rassf1A, Rassf1B, Rassf1C, RDA32, REH3P21
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R5986 (G1)
Quality Score106.008
Status Not validated
Chromosome9
Chromosomal Location107551555-107562267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107551822 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 76 (V76L)
Ref Sequence ENSEMBL: ENSMUSP00000117722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010188] [ENSMUST00000010211] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198] [ENSMUST00000193303]
Predicted Effect probably benign
Transcript: ENSMUST00000010188
SMART Domains Protein: ENSMUSP00000010188
Gene: ENSMUSG00000010044

DomainStartEndE-ValueType
Pfam:zf-MYND 394 430 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010211
SMART Domains Protein: ENSMUSP00000010211
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
RA 124 218 6.26e-24 SMART
PDB:4LGD|H 219 264 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000093786
AA Change: V76L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067
AA Change: V76L

DomainStartEndE-ValueType
C1 44 101 4.7e-7 SMART
low complexity region 168 185 N/A INTRINSIC
RA 194 288 6.26e-24 SMART
PDB:4LGD|H 289 334 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121635
SMART Domains Protein: ENSMUSP00000113037
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
RA 76 170 6.26e-24 SMART
PDB:4LGD|H 171 216 1e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000122225
AA Change: V76L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067
AA Change: V76L

DomainStartEndE-ValueType
C1 44 105 1.92e-3 SMART
low complexity region 172 189 N/A INTRINSIC
RA 198 292 6.26e-24 SMART
Pfam:Nore1-SARAH 299 338 4.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144129
Predicted Effect possibly damaging
Transcript: ENSMUST00000156198
AA Change: V76L

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067
AA Change: V76L

DomainStartEndE-ValueType
Blast:C1 44 83 6e-24 BLAST
SCOP:d1ptq__ 52 82 5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192445
Predicted Effect probably benign
Transcript: ENSMUST00000193303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195627
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous and heterozygous null mice display increased tumor incidence, especially of lung adenomas and lymphomas, and increased sensitivity to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Rassf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rassf1 APN 9 107558311 splice site probably benign
R0570:Rassf1 UTSW 9 107557966 missense probably damaging 1.00
R1548:Rassf1 UTSW 9 107551846 missense probably benign 0.00
R1826:Rassf1 UTSW 9 107558193 missense probably damaging 0.99
R2312:Rassf1 UTSW 9 107557550 missense probably damaging 1.00
R2899:Rassf1 UTSW 9 107554194 missense probably null 0.00
R3902:Rassf1 UTSW 9 107554840 missense probably damaging 1.00
R4705:Rassf1 UTSW 9 107557867 missense probably benign 0.04
R5491:Rassf1 UTSW 9 107561415 missense possibly damaging 0.95
R5733:Rassf1 UTSW 9 107558014 missense probably damaging 1.00
R5863:Rassf1 UTSW 9 107557824 missense probably damaging 1.00
R7571:Rassf1 UTSW 9 107551783 missense possibly damaging 0.70
R7841:Rassf1 UTSW 9 107561545 makesense probably null
R8086:Rassf1 UTSW 9 107557974 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATTGAACTACGCGAGCTGG -3'
(R):5'- ACTAACTCTGCCCAACTGTG -3'

Sequencing Primer
(F):5'- TACGCGAGCTGGCACCG -3'
(R):5'- CCAACTGTGCACGGACAGAG -3'
Posted On2017-06-26