Incidental Mutation 'R5986:Nup107'
ID481662
Institutional Source Beutler Lab
Gene Symbol Nup107
Ensembl Gene ENSMUSG00000052798
Gene Namenucleoporin 107
Synonyms
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location117750621-117792705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117759176 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 752 (Y752C)
Ref Sequence ENSEMBL: ENSMUSP00000129546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064848] [ENSMUST00000167943] [ENSMUST00000218576]
Predicted Effect probably damaging
Transcript: ENSMUST00000064848
AA Change: Y754C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063590
Gene: ENSMUSG00000052798
AA Change: Y754C

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 210 909 2.2e-218 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167943
AA Change: Y752C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129546
Gene: ENSMUSG00000052798
AA Change: Y752C

DomainStartEndE-ValueType
Pfam:Nup84_Nup100 206 909 2.4e-226 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218375
Predicted Effect probably benign
Transcript: ENSMUST00000218576
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleoporin family. The protein is localized to the nuclear rim and is an essential component of the nuclear pore complex (NPC). All molecules entering or leaving the nucleus either diffuse through or are actively transported by the NPC. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a CRISPR-generated allele exhibit reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Nup107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Nup107 APN 10 117763803 missense probably damaging 1.00
IGL00595:Nup107 APN 10 117773352 nonsense probably null
IGL00595:Nup107 APN 10 117773368 critical splice acceptor site probably null
IGL01120:Nup107 APN 10 117770241 splice site probably benign
IGL01420:Nup107 APN 10 117785021 missense probably damaging 1.00
IGL01646:Nup107 APN 10 117781342 missense probably damaging 1.00
IGL01748:Nup107 APN 10 117757274 missense probably benign 0.06
IGL01755:Nup107 APN 10 117774493 missense probably damaging 1.00
IGL01982:Nup107 APN 10 117759340 splice site probably benign
IGL03394:Nup107 APN 10 117782028 missense probably damaging 0.96
R0371:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R1036:Nup107 UTSW 10 117757294 missense probably damaging 0.98
R1186:Nup107 UTSW 10 117777146 nonsense probably null
R1538:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R1555:Nup107 UTSW 10 117751490 splice site probably benign
R1570:Nup107 UTSW 10 117763844 missense possibly damaging 0.49
R1758:Nup107 UTSW 10 117761343 missense probably damaging 1.00
R1856:Nup107 UTSW 10 117750906 missense probably damaging 1.00
R2105:Nup107 UTSW 10 117773320 missense probably damaging 1.00
R2127:Nup107 UTSW 10 117774475 missense possibly damaging 0.69
R4480:Nup107 UTSW 10 117761332 missense probably benign 0.00
R4540:Nup107 UTSW 10 117762020 splice site probably null
R4584:Nup107 UTSW 10 117766368 missense probably benign 0.05
R4878:Nup107 UTSW 10 117751418 missense probably benign 0.17
R4887:Nup107 UTSW 10 117770478 missense probably damaging 1.00
R4921:Nup107 UTSW 10 117770511 missense possibly damaging 0.95
R5960:Nup107 UTSW 10 117790010 missense probably null
R6947:Nup107 UTSW 10 117757274 missense probably benign 0.06
R7092:Nup107 UTSW 10 117790494 missense probably damaging 0.96
R7165:Nup107 UTSW 10 117773362 missense probably damaging 0.98
R7190:Nup107 UTSW 10 117762135 missense probably benign
R7331:Nup107 UTSW 10 117770198 missense probably damaging 0.99
R7405:Nup107 UTSW 10 117770415 missense probably benign 0.02
R7596:Nup107 UTSW 10 117777160 missense probably damaging 1.00
R7644:Nup107 UTSW 10 117770470 missense probably damaging 1.00
R7734:Nup107 UTSW 10 117758012 nonsense probably null
R7918:Nup107 UTSW 10 117782000 missense probably benign 0.00
R7998:Nup107 UTSW 10 117757994 missense probably damaging 1.00
R8060:Nup107 UTSW 10 117763769 missense probably damaging 0.98
R8209:Nup107 UTSW 10 117757931 missense probably benign 0.19
R8226:Nup107 UTSW 10 117757931 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTGGATCTATCACCACCTCTGG -3'
(R):5'- AGTAGAAAGCTCGCCAGGAC -3'

Sequencing Primer
(F):5'- CAGCGGTTTAAAGCACTTGC -3'
(R):5'- TTAATCCCAGCACTAGGGAGAGTTC -3'
Posted On2017-06-26