Mutagenetix > Incidental Mutations

Incidental Mutation 'R5986:Cog5'

481665

Institutional Source

Beutler Lab

Gene Symbol

Cog5

Ensembl Gene

ENSMUSG00000035933

Gene Name

component of oligomeric golgi complex 5

Synonyms

5430405C01Rik, GOLTC1, GTC90

MMRRC Submission

044166-MU

Accession Numbers

Ensembl: ENSMUST00000036862; MGI: 2145130

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R5986 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31654869-31937630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31660717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 32 (D32V)

Ref Sequence

ENSEMBL: ENSMUSP00000044797 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036862]

AlphaFold

Q8C0L8

Predicted Effect

probably benign
Transcript: ENSMUST00000036862
AA Change: D32V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933
AA Change: D32V

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
Pfam:COG5	35	158	3.8e-37	PFAM
Pfam:Vps51	37	120	1.8e-12	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of eight proteins (Cog1-8) which form a Golgi-localized complex (COG) required for normal Golgi morphology and function. The encoded protein is organized with conserved oligomeric Golgi complex components 6, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants. Mutations in this gene result in congenital disorder of glycosylation type 2I.[provided by RefSeq, Jan 2011]

Allele List at MGI

All alleles(99) : Gene trapped(99)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	A	T	14: 49,232,946	L172H	probably damaging	Het
Agl	A	T	3: 116,772,496	F992I	probably damaging	Het
Ampd1	T	C	3: 103,085,397	F152L	probably damaging	Het
Ank2	T	C	3: 127,012,686	H602R	possibly damaging	Het
Ankib1	T	C	5: 3,747,071	D247G	probably damaging	Het
Bccip	T	A	7: 133,720,865	H313Q	probably benign	Het
Ccdc94	G	A	17: 55,962,030	C46Y	probably damaging	Het
Cep250	A	G	2: 155,979,277	E929G	probably damaging	Het
Chl1	C	A	6: 103,709,191	L954I	probably benign	Het
Cyp4f16	C	A	17: 32,544,142	A187E	probably benign	Het
Dffb	A	T	4: 153,965,593	V271E	probably damaging	Het
Dnah8	A	G	17: 30,851,630	Y4430C	possibly damaging	Het
Dpp3	T	C	19: 4,918,357	E229G	probably benign	Het
Fat3	T	A	9: 15,998,317	N2130Y	probably benign	Het
Gm13128	G	T	4: 144,332,753	V345F	probably damaging	Het
Kcnk3	T	C	5: 30,588,378	V21A	possibly damaging	Het
Kif9	G	A	9: 110,490,026	S186N	probably benign	Het
Lhfpl3	C	A	5: 22,746,426	N78K	probably benign	Het
Ly6c1	A	G	15: 75,045,608	S64P	probably damaging	Het
Mapk10	T	C	5: 103,038,580	T59A	probably benign	Het
Mars	A	T	10: 127,304,302	C394*	probably null	Het
Mettl16	T	A	11: 74,792,237	D168E	possibly damaging	Het
Mgat2	A	T	12: 69,185,384	Q244L	probably benign	Het
Mrps30	A	G	13: 118,384,565		probably null	Het
Myrip	C	A	9: 120,461,421	A702E	probably damaging	Het
Nepn	T	C	10: 52,404,072	L420P	probably damaging	Het
Nrn1	A	T	13: 36,734,264	Y9*	probably null	Het
Nup107	T	C	10: 117,759,176	Y752C	probably damaging	Het
Nutm2	A	T	13: 50,474,460	D520V	probably damaging	Het
Olfm2	C	T	9: 20,675,650	C48Y	probably damaging	Het
Olfr27	A	G	9: 39,144,982	N294S	probably null	Het
Olfr592	T	C	7: 103,187,528	F309S	possibly damaging	Het
Osbpl1a	T	A	18: 12,905,081	D271V	probably damaging	Het
Osmr	G	T	15: 6,844,453	D154E	probably benign	Het
Pcdh9	A	G	14: 93,887,048	V562A	probably damaging	Het
Peak1	A	C	9: 56,259,442	S401A	probably benign	Het
Pigk	A	T	3: 152,740,849	H195L	probably benign	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Ppp2r1a	C	T	17: 20,951,346	R28C	probably damaging	Het
Ptbp3	T	C	4: 59,493,311	D123G	probably benign	Het
Ptgr2	G	A	12: 84,308,346	E285K	possibly damaging	Het
Rassf1	G	T	9: 107,551,822	V76L	possibly damaging	Het
Sec22a	A	G	16: 35,314,091	V307A	probably damaging	Het
Skint5	C	T	4: 113,995,648	V18I	probably benign	Het
Slc1a5	T	C	7: 16,782,226	V109A	probably benign	Het
St8sia5	T	A	18: 77,254,782	M396K	possibly damaging	Het
Tiam1	T	C	16: 89,789,186	E602G	probably benign	Het
Tll1	T	C	8: 64,074,263	E408G	probably damaging	Het
Tpsb2	G	A	17: 25,367,134	V109M	probably benign	Het
Trib1	T	A	15: 59,654,602		probably null	Het
Trio	G	T	15: 27,851,933	A765E	possibly damaging	Het
Uggt2	A	T	14: 119,049,426	V193E	probably damaging	Het
Vmn1r115	G	A	7: 20,844,522	P155L	probably benign	Het
Wdr31	A	G	4: 62,455,876	L292S	probably benign	Het
Xrra1	T	C	7: 99,876,255	I127T	probably benign	Het
Zfp442	G	A	2: 150,408,024	Q596*	probably null	Het

Other mutations in Cog5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cog5	APN	12	31685704	missense	probably damaging	1.00
IGL00495:Cog5	APN	12	31837309	missense	probably benign	0.06
IGL00763:Cog5	APN	12	31665532	splice site	probably benign
IGL00789:Cog5	APN	12	31760952	missense	possibly damaging	0.95
IGL01288:Cog5	APN	12	31886206	missense	probably benign	0.13
IGL01315:Cog5	APN	12	31760986	splice site	probably benign
IGL01396:Cog5	APN	12	31894096	missense	probably benign	0.01
IGL02468:Cog5	APN	12	31837358	critical splice donor site	probably null
IGL03030:Cog5	APN	12	31790922	missense	probably damaging	0.99
IGL03346:Cog5	APN	12	31894038	missense	possibly damaging	0.88
R0201:Cog5	UTSW	12	31839841	missense	probably damaging	0.99
R0356:Cog5	UTSW	12	31837181	splice site	probably benign
R0492:Cog5	UTSW	12	31869461	missense	probably damaging	1.00
R0646:Cog5	UTSW	12	31837359	splice site	probably benign
R0971:Cog5	UTSW	12	31919678	missense	probably benign	0.11
R1158:Cog5	UTSW	12	31870057	splice site	probably benign
R1997:Cog5	UTSW	12	31660849	missense	possibly damaging	0.66
R2167:Cog5	UTSW	12	31837289	missense	probably damaging	0.99
R4414:Cog5	UTSW	12	31660854	nonsense	probably null
R4755:Cog5	UTSW	12	31869406	splice site	probably null
R4836:Cog5	UTSW	12	31919733	missense	probably benign	0.07
R5017:Cog5	UTSW	12	31920605	missense	probably benign	0.29
R5256:Cog5	UTSW	12	31886205	missense	probably benign
R6131:Cog5	UTSW	12	31886221	missense	possibly damaging	0.47
R6885:Cog5	UTSW	12	31894199	missense	probably damaging	1.00
R7056:Cog5	UTSW	12	31665469	missense	possibly damaging	0.65
R7177:Cog5	UTSW	12	31760889	missense	probably damaging	1.00
R7182:Cog5	UTSW	12	31685708	missense	probably damaging	1.00
R7418:Cog5	UTSW	12	31833241	missense	probably damaging	1.00
R7445:Cog5	UTSW	12	31919672	missense	possibly damaging	0.64
R7585:Cog5	UTSW	12	31760889	missense	probably damaging	1.00
R8332:Cog5	UTSW	12	31833223	nonsense	probably null
R8722:Cog5	UTSW	12	31919704	missense	possibly damaging	0.82
R8781:Cog5	UTSW	12	31833250	missense	probably damaging	1.00
R8911:Cog5	UTSW	12	31833239	missense	probably damaging	1.00
R8979:Cog5	UTSW	12	31790895	missense	probably benign	0.00
R9153:Cog5	UTSW	12	31660811	missense	possibly damaging	0.87
X0062:Cog5	UTSW	12	31685692	missense	probably benign	0.01
Z1177:Cog5	UTSW	12	31801985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTATTATCACTTGTGTCCTGCGC -3'
(R):5'- AGATGCTGGTAAGTTATGCATTTGC -3'

Sequencing Primer
(F):5'- GCAGCCTGCTCCAGTTC -3'
(R):5'- AAATAAGCTGTCACTTTCGGCTGG -3'

Posted On

2017-06-26