Incidental Mutation 'R5986:Mgat2'
ID481666
Institutional Source Beutler Lab
Gene Symbol Mgat2
Ensembl Gene ENSMUSG00000043998
Gene Namemannoside acetylglucosaminyltransferase 2
SynonymsCDGS2, GNT-II, GNT2
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69184157-69186770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69185384 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 244 (Q244L)
Ref Sequence ENSEMBL: ENSMUSP00000057905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000054544] [ENSMUST00000060579] [ENSMUST00000110619] [ENSMUST00000110620] [ENSMUST00000222699]
Predicted Effect probably benign
Transcript: ENSMUST00000021356
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054544
SMART Domains Protein: ENSMUSP00000059766
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 94 6.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060579
AA Change: Q244L

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057905
Gene: ENSMUSG00000043998
AA Change: Q244L

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:MGAT2 87 435 2.4e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110619
SMART Domains Protein: ENSMUSP00000106249
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 95 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110620
SMART Domains Protein: ENSMUSP00000106250
Gene: ENSMUSG00000049751

DomainStartEndE-ValueType
Pfam:Ribosomal_L44 17 95 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a Golgi enzyme catalyzing an essential step in the conversion of oligomannose to complex N-glycans. The enzyme has the typical glycosyltransferase domains: a short N-terminal cytoplasmic domain, a hydrophobic non-cleavable signal-anchor domain, and a C-terminal catalytic domain. Mutations in this gene may lead to carbohydrate-deficient glycoprotein syndrome, type II. The coding region of this gene is intronless. Transcript variants with a spliced 5' UTR may exist, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice recapitulate aspects of the phenotype exhibited by patients with congenital disorders of glycosylation (CDG), particularly type IIa. Most null mice died either embyronically or postnataly and exhibited muscular, gastrointestinal, hematologic, and osteogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Mgat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01723:Mgat2 APN 12 69185641 missense probably damaging 0.99
IGL02428:Mgat2 APN 12 69184784 missense probably benign 0.45
IGL03064:Mgat2 APN 12 69185003 missense probably damaging 1.00
R0554:Mgat2 UTSW 12 69185392 missense probably benign
R1698:Mgat2 UTSW 12 69185719 missense probably benign
R1759:Mgat2 UTSW 12 69185527 missense probably benign 0.11
R2130:Mgat2 UTSW 12 69185294 missense probably damaging 1.00
R5982:Mgat2 UTSW 12 69185680 missense probably damaging 1.00
R6265:Mgat2 UTSW 12 69184793 missense probably benign
R6699:Mgat2 UTSW 12 69184781 missense probably damaging 0.99
R6841:Mgat2 UTSW 12 69185633 missense probably damaging 0.99
R7692:Mgat2 UTSW 12 69184670 missense probably damaging 1.00
R8005:Mgat2 UTSW 12 69185948 missense probably damaging 1.00
X0026:Mgat2 UTSW 12 69185107 missense probably damaging 1.00
X0060:Mgat2 UTSW 12 69185326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGATTGCCCCAGAGACC -3'
(R):5'- TATGCATCTCGGGTCAAGGC -3'

Sequencing Primer
(F):5'- CCTAAAGAAGAATGCAGCTCTG -3'
(R):5'- TCAAGGCTAGCCCCATGTTGTG -3'
Posted On2017-06-26