Incidental Mutation 'R5986:Nrn1'
ID481668
Institutional Source Beutler Lab
Gene Symbol Nrn1
Ensembl Gene ENSMUSG00000039114
Gene Nameneuritin 1
Synonymscpg15, 0710008J23Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location36725361-36735131 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 36734264 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 9 (Y9*)
Ref Sequence ENSEMBL: ENSMUSP00000153173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037623] [ENSMUST00000122286] [ENSMUST00000223611] [ENSMUST00000224323] [ENSMUST00000224960]
Predicted Effect probably null
Transcript: ENSMUST00000037623
AA Change: Y9*
SMART Domains Protein: ENSMUSP00000040900
Gene: ENSMUSG00000039114
AA Change: Y9*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:NRN1 31 120 1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122286
SMART Domains Protein: ENSMUSP00000113721
Gene: ENSMUSG00000039114

DomainStartEndE-ValueType
Pfam:NRN1 47 133 2.7e-42 PFAM
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223611
Predicted Effect probably benign
Transcript: ENSMUST00000224323
Predicted Effect probably null
Transcript: ENSMUST00000224960
AA Change: Y9*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body length and body weight, delayed axonal, dendritic, and synaptic development, reduced dendritic spine maintenance leading to gradual spine loss, and impaired associative and spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Nrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nrn1 APN 13 36730216 missense probably damaging 1.00
IGL02801:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02816:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02838:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02859:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02881:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02900:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02927:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02938:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02942:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL03144:Nrn1 APN 13 36730106 critical splice donor site probably null
IGL02802:Nrn1 UTSW 13 36730106 critical splice donor site probably null
R0172:Nrn1 UTSW 13 36730570 missense probably benign
R2126:Nrn1 UTSW 13 36730206 missense probably damaging 1.00
R7226:Nrn1 UTSW 13 36730603 missense probably benign 0.03
R7426:Nrn1 UTSW 13 36726851 missense probably damaging 1.00
R8224:Nrn1 UTSW 13 36734284 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGAGCTAATGCCCCGACTC -3'
(R):5'- AGTGAACCATTCCCAGCTC -3'

Sequencing Primer
(F):5'- ACTCAGGGAGTCTGCAGG -3'
(R):5'- CCCGCGTTCTCTAAACTA -3'
Posted On2017-06-26