Incidental Mutation 'R5986:Sec22a'
ID481678
Institutional Source Beutler Lab
Gene Symbol Sec22a
Ensembl Gene ENSMUSG00000034473
Gene NameSEC22 homolog A, vesicle trafficking protein
SynonymsSec22l2, 1810005C06Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35311131-35363918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35314091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000039568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043521] [ENSMUST00000154064] [ENSMUST00000232420]
Predicted Effect probably damaging
Transcript: ENSMUST00000043521
AA Change: V307A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039568
Gene: ENSMUSG00000034473
AA Change: V307A

DomainStartEndE-ValueType
Longin 36 118 3.01e-23 SMART
transmembrane domain 188 210 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
transmembrane domain 254 271 N/A INTRINSIC
transmembrane domain 276 295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154064
Predicted Effect probably damaging
Transcript: ENSMUST00000232420
AA Change: V285A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the member of the SEC22 family of vesicle trafficking proteins. This protein has similarity to rat SEC22 and may act in the early stages of the secretory pathway. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osbpl1a T A 18: 12,905,081 D271V probably damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Sec22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Sec22a APN 16 35314100 missense probably damaging 1.00
IGL03249:Sec22a APN 16 35347763 missense probably damaging 1.00
R0681:Sec22a UTSW 16 35361556 splice site probably null
R1568:Sec22a UTSW 16 35347628 missense probably benign 0.17
R1634:Sec22a UTSW 16 35318873 intron probably benign
R1863:Sec22a UTSW 16 35347718 missense probably damaging 1.00
R2200:Sec22a UTSW 16 35314157 missense probably damaging 0.97
R4114:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R4115:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R4116:Sec22a UTSW 16 35318832 missense probably damaging 1.00
R5086:Sec22a UTSW 16 35347742 nonsense probably null
R7042:Sec22a UTSW 16 35329515 missense probably benign 0.23
R7623:Sec22a UTSW 16 35329524 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGTGATGGCCTGACATTCCAC -3'
(R):5'- AGCTGGCGGAATGTCAAGTC -3'

Sequencing Primer
(F):5'- GATGGCCTGACATTCCACTGTAG -3'
(R):5'- CTGGCGGAATGTCAAGTCATTTC -3'
Posted On2017-06-26