Incidental Mutation 'R5986:Dnah8'
ID 481682
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms P1-Loop, Dnahc8, Hst6.7b
MMRRC Submission 044166-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R5986 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 30845909-31094736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31070604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 4430 (Y4430C)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000170651
AA Change: Y4430C

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: Y4430C

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,566,145 (GRCm39) F992I probably damaging Het
Ampd1 T C 3: 102,992,713 (GRCm39) F152L probably damaging Het
Ank2 T C 3: 126,806,335 (GRCm39) H602R possibly damaging Het
Ankib1 T C 5: 3,797,071 (GRCm39) D247G probably damaging Het
Bccip T A 7: 133,322,594 (GRCm39) H313Q probably benign Het
Ccdc198 A T 14: 49,470,403 (GRCm39) L172H probably damaging Het
Cep250 A G 2: 155,821,197 (GRCm39) E929G probably damaging Het
Chl1 C A 6: 103,686,152 (GRCm39) L954I probably benign Het
Cog5 A T 12: 31,710,716 (GRCm39) D32V probably benign Het
Cyp4f16 C A 17: 32,763,116 (GRCm39) A187E probably benign Het
Dffb A T 4: 154,050,050 (GRCm39) V271E probably damaging Het
Dpp3 T C 19: 4,968,385 (GRCm39) E229G probably benign Het
Fat3 T A 9: 15,909,613 (GRCm39) N2130Y probably benign Het
Kcnk3 T C 5: 30,745,722 (GRCm39) V21A possibly damaging Het
Kif9 G A 9: 110,319,094 (GRCm39) S186N probably benign Het
Lhfpl3 C A 5: 22,951,424 (GRCm39) N78K probably benign Het
Ly6c1 A G 15: 74,917,457 (GRCm39) S64P probably damaging Het
Mapk10 T C 5: 103,186,446 (GRCm39) T59A probably benign Het
Mars1 A T 10: 127,140,171 (GRCm39) C394* probably null Het
Mettl16 T A 11: 74,683,063 (GRCm39) D168E possibly damaging Het
Mgat2 A T 12: 69,232,158 (GRCm39) Q244L probably benign Het
Mrps30 A G 13: 118,521,101 (GRCm39) probably null Het
Myrip C A 9: 120,290,487 (GRCm39) A702E probably damaging Het
Nepn T C 10: 52,280,168 (GRCm39) L420P probably damaging Het
Nrn1 A T 13: 36,918,238 (GRCm39) Y9* probably null Het
Nup107 T C 10: 117,595,081 (GRCm39) Y752C probably damaging Het
Nutm2 A T 13: 50,628,496 (GRCm39) D520V probably damaging Het
Olfm2 C T 9: 20,586,946 (GRCm39) C48Y probably damaging Het
Or52j3 T C 7: 102,836,735 (GRCm39) F309S possibly damaging Het
Or8g19 A G 9: 39,056,278 (GRCm39) N294S probably null Het
Osbpl1a T A 18: 13,038,138 (GRCm39) D271V probably damaging Het
Osmr G T 15: 6,873,934 (GRCm39) D154E probably benign Het
Pcdh9 A G 14: 94,124,484 (GRCm39) V562A probably damaging Het
Peak1 A C 9: 56,166,726 (GRCm39) S401A probably benign Het
Pigk A T 3: 152,446,486 (GRCm39) H195L probably benign Het
Plekha6 G C 1: 133,200,045 (GRCm39) R208P possibly damaging Het
Ppp2r1a C T 17: 21,171,608 (GRCm39) R28C probably damaging Het
Pramel30 G T 4: 144,059,323 (GRCm39) V345F probably damaging Het
Ptbp3 T C 4: 59,493,311 (GRCm39) D123G probably benign Het
Ptgr2 G A 12: 84,355,120 (GRCm39) E285K possibly damaging Het
Rassf1 G T 9: 107,429,021 (GRCm39) V76L possibly damaging Het
Sec22a A G 16: 35,134,461 (GRCm39) V307A probably damaging Het
Skint5 C T 4: 113,852,845 (GRCm39) V18I probably benign Het
Slc1a5 T C 7: 16,516,151 (GRCm39) V109A probably benign Het
St8sia5 T A 18: 77,342,478 (GRCm39) M396K possibly damaging Het
Tiam1 T C 16: 89,586,074 (GRCm39) E602G probably benign Het
Tll1 T C 8: 64,527,297 (GRCm39) E408G probably damaging Het
Tpsb2 G A 17: 25,586,108 (GRCm39) V109M probably benign Het
Trib1 T A 15: 59,526,451 (GRCm39) probably null Het
Trio G T 15: 27,852,019 (GRCm39) A765E possibly damaging Het
Uggt2 A T 14: 119,286,838 (GRCm39) V193E probably damaging Het
Vmn1r115 G A 7: 20,578,447 (GRCm39) P155L probably benign Het
Wdr31 A G 4: 62,374,113 (GRCm39) L292S probably benign Het
Xrra1 T C 7: 99,525,462 (GRCm39) I127T probably benign Het
Yju2 G A 17: 56,269,030 (GRCm39) C46Y probably damaging Het
Zfp442 G A 2: 150,249,944 (GRCm39) Q596* probably null Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,896,150 (GRCm39) missense probably benign 0.06
IGL00508:Dnah8 APN 17 31,074,904 (GRCm39) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 31,034,677 (GRCm39) nonsense probably null
IGL00551:Dnah8 APN 17 30,882,452 (GRCm39) nonsense probably null
IGL00732:Dnah8 APN 17 30,875,615 (GRCm39) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,986,880 (GRCm39) nonsense probably null
IGL00840:Dnah8 APN 17 31,009,915 (GRCm39) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 31,038,250 (GRCm39) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,925,431 (GRCm39) nonsense probably null
IGL00976:Dnah8 APN 17 31,070,684 (GRCm39) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,854,979 (GRCm39) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,998,890 (GRCm39) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,902,688 (GRCm39) splice site probably benign
IGL01515:Dnah8 APN 17 30,867,459 (GRCm39) missense probably benign
IGL01723:Dnah8 APN 17 30,927,445 (GRCm39) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,970,565 (GRCm39) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,955,115 (GRCm39) missense probably benign
IGL01958:Dnah8 APN 17 31,074,869 (GRCm39) splice site probably benign
IGL01968:Dnah8 APN 17 30,875,572 (GRCm39) nonsense probably null
IGL02093:Dnah8 APN 17 30,936,854 (GRCm39) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,867,391 (GRCm39) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 31,013,737 (GRCm39) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,925,487 (GRCm39) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,868,747 (GRCm39) nonsense probably null
IGL02259:Dnah8 APN 17 30,978,588 (GRCm39) missense probably benign
IGL02263:Dnah8 APN 17 30,948,139 (GRCm39) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,932,021 (GRCm39) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,966,231 (GRCm39) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,986,785 (GRCm39) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 31,013,770 (GRCm39) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 31,049,819 (GRCm39) missense probably benign 0.01
IGL02392:Dnah8 APN 17 31,037,025 (GRCm39) splice site probably benign
IGL02414:Dnah8 APN 17 30,919,387 (GRCm39) missense probably benign
IGL02455:Dnah8 APN 17 30,891,308 (GRCm39) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,887,269 (GRCm39) missense probably benign
IGL02831:Dnah8 APN 17 30,931,250 (GRCm39) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,988,671 (GRCm39) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,940,084 (GRCm39) nonsense probably null
IGL02954:Dnah8 APN 17 30,923,809 (GRCm39) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,965,735 (GRCm39) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,937,980 (GRCm39) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,905,347 (GRCm39) splice site probably benign
IGL03086:Dnah8 APN 17 30,961,754 (GRCm39) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 31,003,118 (GRCm39) missense probably benign
IGL03176:Dnah8 APN 17 30,913,011 (GRCm39) missense probably benign
IGL03191:Dnah8 APN 17 30,945,804 (GRCm39) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 31,034,639 (GRCm39) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,892,894 (GRCm39) splice site probably null
IGL03255:Dnah8 APN 17 30,960,355 (GRCm39) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,891,323 (GRCm39) missense probably benign
IGL03348:Dnah8 APN 17 30,965,960 (GRCm39) missense probably damaging 0.99
Alternator UTSW 17 30,984,609 (GRCm39) missense probably benign
armature UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
Brush UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
Dynos UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
joule UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
solenoid UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,854,437 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,451 (GRCm39) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,854,439 (GRCm39) small deletion probably benign
I2288:Dnah8 UTSW 17 30,882,428 (GRCm39) missense probably benign
P0029:Dnah8 UTSW 17 30,984,694 (GRCm39) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,927,419 (GRCm39) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,882,290 (GRCm39) missense probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0035:Dnah8 UTSW 17 30,902,595 (GRCm39) splice site probably benign
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,984,685 (GRCm39) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,974,093 (GRCm39) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 31,003,064 (GRCm39) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0164:Dnah8 UTSW 17 30,967,639 (GRCm39) missense probably benign
R0184:Dnah8 UTSW 17 30,902,657 (GRCm39) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,984,653 (GRCm39) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,909,245 (GRCm39) missense probably benign
R0268:Dnah8 UTSW 17 30,988,681 (GRCm39) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,955,130 (GRCm39) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 31,090,325 (GRCm39) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,927,364 (GRCm39) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,920,955 (GRCm39) missense probably benign
R0470:Dnah8 UTSW 17 30,927,514 (GRCm39) splice site probably benign
R0477:Dnah8 UTSW 17 30,974,054 (GRCm39) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R0499:Dnah8 UTSW 17 30,934,483 (GRCm39) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,937,935 (GRCm39) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,927,332 (GRCm39) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,903,147 (GRCm39) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,955,129 (GRCm39) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,923,636 (GRCm39) missense probably benign
R0843:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 31,022,217 (GRCm39) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,892,894 (GRCm39) splice site probably null
R1102:Dnah8 UTSW 17 31,073,738 (GRCm39) splice site probably null
R1137:Dnah8 UTSW 17 31,074,910 (GRCm39) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,939,974 (GRCm39) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,956,269 (GRCm39) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 31,059,596 (GRCm39) nonsense probably null
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30,914,147 (GRCm39) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1470:Dnah8 UTSW 17 30,966,251 (GRCm39) nonsense probably null
R1497:Dnah8 UTSW 17 30,971,049 (GRCm39) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,892,862 (GRCm39) missense probably benign
R1541:Dnah8 UTSW 17 30,966,221 (GRCm39) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,854,638 (GRCm39) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,932,072 (GRCm39) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,944,098 (GRCm39) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 31,073,914 (GRCm39) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,988,625 (GRCm39) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,998,890 (GRCm39) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,941,911 (GRCm39) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,927,381 (GRCm39) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,903,160 (GRCm39) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,950,154 (GRCm39) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,854,479 (GRCm39) missense unknown
R1935:Dnah8 UTSW 17 30,945,870 (GRCm39) splice site probably benign
R1940:Dnah8 UTSW 17 30,950,181 (GRCm39) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,931,359 (GRCm39) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,950,133 (GRCm39) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,977,255 (GRCm39) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,854,632 (GRCm39) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,956,232 (GRCm39) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,872,367 (GRCm39) missense probably benign
R2180:Dnah8 UTSW 17 31,059,621 (GRCm39) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,892,809 (GRCm39) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 31,013,718 (GRCm39) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30,990,846 (GRCm39) missense probably benign
R2357:Dnah8 UTSW 17 31,093,909 (GRCm39) missense probably benign 0.00
R2360:Dnah8 UTSW 17 30,896,178 (GRCm39) missense probably benign 0.22
R2496:Dnah8 UTSW 17 31,070,705 (GRCm39) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,960,339 (GRCm39) nonsense probably null
R2509:Dnah8 UTSW 17 30,994,019 (GRCm39) missense probably benign 0.02
R3114:Dnah8 UTSW 17 31,052,542 (GRCm39) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,958,631 (GRCm39) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,958,622 (GRCm39) nonsense probably null
R3747:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3748:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3749:Dnah8 UTSW 17 31,003,148 (GRCm39) nonsense probably null
R3787:Dnah8 UTSW 17 30,974,015 (GRCm39) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,889,621 (GRCm39) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,882,396 (GRCm39) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 31,073,872 (GRCm39) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 31,073,911 (GRCm39) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,913,039 (GRCm39) splice site probably benign
R4091:Dnah8 UTSW 17 30,988,813 (GRCm39) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,967,533 (GRCm39) missense probably benign
R4326:Dnah8 UTSW 17 30,971,066 (GRCm39) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,944,072 (GRCm39) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,971,120 (GRCm39) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 31,032,125 (GRCm39) missense probably benign
R4475:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,919,380 (GRCm39) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,881,026 (GRCm39) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,970,541 (GRCm39) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,903,211 (GRCm39) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,902,608 (GRCm39) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,944,140 (GRCm39) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 31,070,721 (GRCm39) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,994,035 (GRCm39) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,986,898 (GRCm39) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,965,949 (GRCm39) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 31,059,688 (GRCm39) critical splice donor site probably null
R4913:Dnah8 UTSW 17 31,038,113 (GRCm39) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,948,116 (GRCm39) missense probably benign
R4969:Dnah8 UTSW 17 30,941,988 (GRCm39) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,875,959 (GRCm39) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,882,275 (GRCm39) missense probably benign 0.00
R5001:Dnah8 UTSW 17 31,006,159 (GRCm39) missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,955,070 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5075:Dnah8 UTSW 17 31,019,505 (GRCm39) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,958,731 (GRCm39) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,950,012 (GRCm39) missense probably benign 0.02
R5121:Dnah8 UTSW 17 31,029,327 (GRCm39) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,984,571 (GRCm39) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,931,269 (GRCm39) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,965,739 (GRCm39) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 31,009,891 (GRCm39) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,919,393 (GRCm39) missense probably benign
R5358:Dnah8 UTSW 17 30,965,928 (GRCm39) missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5404:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5482:Dnah8 UTSW 17 31,019,521 (GRCm39) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 31,009,930 (GRCm39) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,971,890 (GRCm39) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,925,360 (GRCm39) missense probably benign 0.00
R5640:Dnah8 UTSW 17 31,022,082 (GRCm39) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 31,019,561 (GRCm39) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,956,307 (GRCm39) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 31,022,235 (GRCm39) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5699:Dnah8 UTSW 17 31,029,298 (GRCm39) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,937,981 (GRCm39) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,909,235 (GRCm39) missense probably benign 0.01
R5790:Dnah8 UTSW 17 31,093,978 (GRCm39) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,947,165 (GRCm39) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 31,013,737 (GRCm39) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 31,013,691 (GRCm39) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,875,659 (GRCm39) missense probably benign 0.32
R5979:Dnah8 UTSW 17 31,034,638 (GRCm39) nonsense probably null
R5999:Dnah8 UTSW 17 30,882,279 (GRCm39) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,966,239 (GRCm39) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,966,828 (GRCm39) nonsense probably null
R6239:Dnah8 UTSW 17 31,029,333 (GRCm39) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,984,609 (GRCm39) missense probably benign
R6443:Dnah8 UTSW 17 30,990,859 (GRCm39) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,965,964 (GRCm39) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,882,266 (GRCm39) splice site probably null
R6765:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,967,542 (GRCm39) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,854,640 (GRCm39) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,984,698 (GRCm39) frame shift probably null
R6788:Dnah8 UTSW 17 30,867,439 (GRCm39) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,960,147 (GRCm39) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,929,525 (GRCm39) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,981,653 (GRCm39) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,965,933 (GRCm39) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 31,013,633 (GRCm39) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,986,899 (GRCm39) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,958,712 (GRCm39) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,881,065 (GRCm39) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,862,249 (GRCm39) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,923,698 (GRCm39) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,960,152 (GRCm39) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 31,090,366 (GRCm39) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,988,618 (GRCm39) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,863,591 (GRCm39) missense probably benign 0.01
R7309:Dnah8 UTSW 17 31,093,988 (GRCm39) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 31,003,099 (GRCm39) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,986,939 (GRCm39) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,923,743 (GRCm39) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,925,363 (GRCm39) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 31,006,165 (GRCm39) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,994,077 (GRCm39) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 31,032,069 (GRCm39) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 31,004,081 (GRCm39) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,868,651 (GRCm39) missense probably benign 0.00
R7685:Dnah8 UTSW 17 30,876,947 (GRCm39) missense probably damaging 1.00
R7793:Dnah8 UTSW 17 31,074,918 (GRCm39) missense probably benign 0.20
R7827:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R7866:Dnah8 UTSW 17 31,093,901 (GRCm39) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,882,348 (GRCm39) missense probably benign
R7891:Dnah8 UTSW 17 30,931,263 (GRCm39) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,963,498 (GRCm39) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,960,311 (GRCm39) nonsense probably null
R8076:Dnah8 UTSW 17 31,003,127 (GRCm39) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,892,797 (GRCm39) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 31,090,393 (GRCm39) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8270:Dnah8 UTSW 17 31,059,687 (GRCm39) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,984,701 (GRCm39) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,988,805 (GRCm39) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8348:Dnah8 UTSW 17 30,955,121 (GRCm39) missense probably damaging 0.96
R8354:Dnah8 UTSW 17 30,862,234 (GRCm39) missense probably benign 0.17
R8355:Dnah8 UTSW 17 30,914,152 (GRCm39) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8448:Dnah8 UTSW 17 30,892,814 (GRCm39) missense probably benign
R8459:Dnah8 UTSW 17 30,944,221 (GRCm39) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,875,603 (GRCm39) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,940,108 (GRCm39) missense probably benign
R8524:Dnah8 UTSW 17 30,934,472 (GRCm39) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,940,084 (GRCm39) nonsense probably null
R8698:Dnah8 UTSW 17 31,094,009 (GRCm39) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,960,289 (GRCm39) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R8781:Dnah8 UTSW 17 30,944,078 (GRCm39) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 31,013,712 (GRCm39) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,981,616 (GRCm39) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,927,286 (GRCm39) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 31,070,628 (GRCm39) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 31,009,807 (GRCm39) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,956,401 (GRCm39) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,975,729 (GRCm39) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,854,647 (GRCm39) missense probably benign 0.01
R9280:Dnah8 UTSW 17 31,004,071 (GRCm39) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,944,099 (GRCm39) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,990,857 (GRCm39) missense probably benign
R9347:Dnah8 UTSW 17 30,927,333 (GRCm39) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,872,361 (GRCm39) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 31,029,297 (GRCm39) missense probably benign 0.02
R9458:Dnah8 UTSW 17 31,049,777 (GRCm39) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9518:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9524:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9564:Dnah8 UTSW 17 30,932,021 (GRCm39) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9599:Dnah8 UTSW 17 30,979,841 (GRCm39) frame shift probably null
R9641:Dnah8 UTSW 17 30,932,029 (GRCm39) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,998,112 (GRCm39) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 31,037,115 (GRCm39) missense probably benign
R9789:Dnah8 UTSW 17 30,980,104 (GRCm39) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,854,450 (GRCm39) frame shift probably null
X0001:Dnah8 UTSW 17 30,967,654 (GRCm39) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 31,038,160 (GRCm39) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,867,514 (GRCm39) missense probably benign
Z1177:Dnah8 UTSW 17 30,932,069 (GRCm39) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,913,007 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGAAGGCTGACAGTAACATC -3'
(R):5'- TGTCTCAGGATCTTCCAGCAG -3'

Sequencing Primer
(F):5'- TGAAGGCTGACAGTAACATCTCTAC -3'
(R):5'- CAGGAAGGGCATGGCTCAC -3'
Posted On 2017-06-26