Incidental Mutation 'R5986:Osbpl1a'
ID481685
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Nameoxysterol binding protein-like 1A
SynonymsLOC328902, G430090F17Rik
MMRRC Submission 044166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5986 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12755314-12941841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12905081 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 271 (D271V)
Ref Sequence ENSEMBL: ENSMUSP00000113491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000122175] [ENSMUST00000147197]
Predicted Effect probably damaging
Transcript: ENSMUST00000074352
AA Change: D271V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: D271V

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122175
AA Change: D271V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113491
Gene: ENSMUSG00000044252
AA Change: D271V

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 335 3.63e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132594
Predicted Effect probably benign
Transcript: ENSMUST00000147197
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,232,946 L172H probably damaging Het
Agl A T 3: 116,772,496 F992I probably damaging Het
Ampd1 T C 3: 103,085,397 F152L probably damaging Het
Ank2 T C 3: 127,012,686 H602R possibly damaging Het
Ankib1 T C 5: 3,747,071 D247G probably damaging Het
Bccip T A 7: 133,720,865 H313Q probably benign Het
Ccdc94 G A 17: 55,962,030 C46Y probably damaging Het
Cep250 A G 2: 155,979,277 E929G probably damaging Het
Chl1 C A 6: 103,709,191 L954I probably benign Het
Cog5 A T 12: 31,660,717 D32V probably benign Het
Cyp4f16 C A 17: 32,544,142 A187E probably benign Het
Dffb A T 4: 153,965,593 V271E probably damaging Het
Dnah8 A G 17: 30,851,630 Y4430C possibly damaging Het
Dpp3 T C 19: 4,918,357 E229G probably benign Het
Fat3 T A 9: 15,998,317 N2130Y probably benign Het
Gm13128 G T 4: 144,332,753 V345F probably damaging Het
Kcnk3 T C 5: 30,588,378 V21A possibly damaging Het
Kif9 G A 9: 110,490,026 S186N probably benign Het
Lhfpl3 C A 5: 22,746,426 N78K probably benign Het
Ly6c1 A G 15: 75,045,608 S64P probably damaging Het
Mapk10 T C 5: 103,038,580 T59A probably benign Het
Mars A T 10: 127,304,302 C394* probably null Het
Mettl16 T A 11: 74,792,237 D168E possibly damaging Het
Mgat2 A T 12: 69,185,384 Q244L probably benign Het
Mrps30 A G 13: 118,384,565 probably null Het
Myrip C A 9: 120,461,421 A702E probably damaging Het
Nepn T C 10: 52,404,072 L420P probably damaging Het
Nrn1 A T 13: 36,734,264 Y9* probably null Het
Nup107 T C 10: 117,759,176 Y752C probably damaging Het
Nutm2 A T 13: 50,474,460 D520V probably damaging Het
Olfm2 C T 9: 20,675,650 C48Y probably damaging Het
Olfr27 A G 9: 39,144,982 N294S probably null Het
Olfr592 T C 7: 103,187,528 F309S possibly damaging Het
Osmr G T 15: 6,844,453 D154E probably benign Het
Pcdh9 A G 14: 93,887,048 V562A probably damaging Het
Peak1 A C 9: 56,259,442 S401A probably benign Het
Pigk A T 3: 152,740,849 H195L probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp2r1a C T 17: 20,951,346 R28C probably damaging Het
Ptbp3 T C 4: 59,493,311 D123G probably benign Het
Ptgr2 G A 12: 84,308,346 E285K possibly damaging Het
Rassf1 G T 9: 107,551,822 V76L possibly damaging Het
Sec22a A G 16: 35,314,091 V307A probably damaging Het
Skint5 C T 4: 113,995,648 V18I probably benign Het
Slc1a5 T C 7: 16,782,226 V109A probably benign Het
St8sia5 T A 18: 77,254,782 M396K possibly damaging Het
Tiam1 T C 16: 89,789,186 E602G probably benign Het
Tll1 T C 8: 64,074,263 E408G probably damaging Het
Tpsb2 G A 17: 25,367,134 V109M probably benign Het
Trib1 T A 15: 59,654,602 probably null Het
Trio G T 15: 27,851,933 A765E possibly damaging Het
Uggt2 A T 14: 119,049,426 V193E probably damaging Het
Vmn1r115 G A 7: 20,844,522 P155L probably benign Het
Wdr31 A G 4: 62,455,876 L292S probably benign Het
Xrra1 T C 7: 99,876,255 I127T probably benign Het
Zfp442 G A 2: 150,408,024 Q596* probably null Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12757626 missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 12905075 missense probably benign
IGL01450:Osbpl1a APN 18 12871095 missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 12933581 missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12763575 missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12756214 missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12766824 missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12841313 nonsense probably null
IGL02451:Osbpl1a APN 18 12914493 splice site probably benign
IGL02490:Osbpl1a APN 18 12882284 unclassified probably benign
IGL02884:Osbpl1a APN 18 12819578 nonsense probably null
R0084:Osbpl1a UTSW 18 12757612 missense probably benign 0.07
R0266:Osbpl1a UTSW 18 12871163 splice site probably null
R0565:Osbpl1a UTSW 18 12759444 missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 12882279 critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12757690 missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 12882194 critical splice donor site probably null
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1475:Osbpl1a UTSW 18 12757680 missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12758839 missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12788316 splice site probably null
R1930:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R1931:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12759400 missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 12871173 missense probably benign 0.06
R2504:Osbpl1a UTSW 18 12905031 missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12766899 missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 12871072 unclassified probably benign
R4306:Osbpl1a UTSW 18 12819595 missense probably benign
R4835:Osbpl1a UTSW 18 12768536 critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12763537 missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12762640 missense probably benign 0.12
R5224:Osbpl1a UTSW 18 12933696 missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12758853 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12841192 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12892262 missense probably benign 0.22
R5833:Osbpl1a UTSW 18 12788362 missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12756261 missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12756224 missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12766963 missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12841253 nonsense probably null
R7154:Osbpl1a UTSW 18 12768592 missense probably benign 0.00
R7459:Osbpl1a UTSW 18 12933585 missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 12933600 missense probably benign 0.44
R7797:Osbpl1a UTSW 18 12882264 missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 12914521 missense probably benign 0.01
R8084:Osbpl1a UTSW 18 12905042 missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12768586 missense probably benign 0.02
X0027:Osbpl1a UTSW 18 12759503 missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 12906923 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCTAACTTCAGTTGCTCTCAAATGTG -3'
(R):5'- TTGAATCCAGATACATCAGCATGG -3'

Sequencing Primer
(F):5'- GAAGCCCATGGATTCTCTAGAGTC -3'
(R):5'- TTGTCCTTTTCCTTTAGAGTTCAAG -3'
Posted On2017-06-26