Mutagenetix > Incidental Mutation

Incidental Mutation 'R5987:Rif1'

481695

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

044167-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5987 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 52095844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 614 (L614V)

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069794
AA Change: L614V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: L614V

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112693
AA Change: L614V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: L614V

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Meta Mutation Damage Score

0.2069

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	C	1: 71,258,098	L2411R	probably damaging	Het
Als2	A	G	1: 59,206,587	W577R	probably damaging	Het
Aox2	C	A	1: 58,307,359	R551S	probably benign	Het
Areg	A	T	5: 91,146,718	H245L	possibly damaging	Het
Arhgap35	T	C	7: 16,563,467	T558A	possibly damaging	Het
Arhgef28	A	T	13: 97,936,860	C1322*	probably null	Het
Arhgef38	T	C	3: 133,206,958	R107G	possibly damaging	Het
Atf7ip	T	A	6: 136,571,502	F695L	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Bche	T	G	3: 73,648,678	Q549P	possibly damaging	Het
Blnk	A	G	19: 40,929,289	F417L	possibly damaging	Het
Bloc1s1	T	G	10: 128,923,386	K17T	probably damaging	Het
C330018D20Rik	G	T	18: 56,957,896	T65K	probably damaging	Het
Cers1	T	A	8: 70,321,578	S162T	possibly damaging	Het
Cgn	T	C	3: 94,779,522	K157E	probably benign	Het
Cldn7	G	A	11: 69,967,668	R196Q	probably benign	Het
Clrn2	C	A	5: 45,454,027	Q73K	probably benign	Het
Cmss1	A	G	16: 57,302,245	V262A	probably benign	Het
Cpb2	T	A	14: 75,260,688	V97E	probably damaging	Het
Ctnnd2	G	A	15: 30,683,241	V463I	probably benign	Het
Cyp7a1	A	T	4: 6,268,476	S416R	probably benign	Het
Dip2b	C	T	15: 100,190,079	R965C	probably damaging	Het
Dkk3	T	C	7: 112,150,658	T102A	probably benign	Het
Dmap1	C	A	4: 117,680,842		probably null	Het
Dnah12	C	A	14: 26,886,871	D3872E	possibly damaging	Het
Dnah7b	A	G	1: 46,119,398		probably null	Het
Dnaic1	C	T	4: 41,632,391	T575I	probably benign	Het
Dsg1a	T	A	18: 20,331,542	Y365N	probably damaging	Het
Dusp11	T	A	6: 85,959,233	K18*	probably null	Het
E2f2	A	T	4: 136,172,934	T52S	probably benign	Het
Elavl4	A	G	4: 110,290,644	L13S	probably benign	Het
Epor	T	C	9: 21,962,276	D59G	possibly damaging	Het
Eral1	A	G	11: 78,080,233	C43R	possibly damaging	Het
Fam135b	A	G	15: 71,490,848	V228A	probably benign	Het
Gba	T	C	3: 89,205,822	S187P	probably damaging	Het
Gcc2	G	T	10: 58,255,847		probably benign	Het
Gdap2	C	A	3: 100,202,256		probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm8251	A	T	1: 44,057,257	N1560K	probably benign	Het
Gpr160	T	C	3: 30,896,463	L228P	probably benign	Het
Gsdmc2	A	C	15: 63,830,866	V184G	probably benign	Het
Gtf2e2	A	T	8: 33,776,052	K252M	probably damaging	Het
Gtf2e2	G	T	8: 33,776,053	K252N	probably benign	Het
Gys1	T	C	7: 45,438,105	Y102H	probably benign	Het
Hist1h4b	A	G	13: 23,757,226	D69G	probably damaging	Het
Ifit3b	A	C	19: 34,612,198	D258A	probably damaging	Het
Itpr3	T	A	17: 27,104,601	M1200K	probably damaging	Het
Kcng4	A	T	8: 119,626,359	F271I	probably damaging	Het
Klhdc2	C	T	12: 69,303,613	S144L	possibly damaging	Het
Lhcgr	A	G	17: 88,755,578	F222S	probably damaging	Het
Lrp5	C	G	19: 3,628,299	G519R	probably damaging	Het
Magel2	T	C	7: 62,378,767	V473A	probably benign	Het
Map1a	T	C	2: 121,304,295	V1864A	possibly damaging	Het
Mast4	T	A	13: 102,758,734	Q760H	probably damaging	Het
Mertk	A	G	2: 128,771,374	N437D	probably benign	Het
Mettl18	G	A	1: 163,996,775	V222I	probably benign	Het
Mical2	C	T	7: 112,334,948	T782M	probably benign	Het
Mocos	T	A	18: 24,686,693	V664E	probably damaging	Het
Neb	G	T	2: 52,295,294	N975K	probably benign	Het
Nectin3	A	T	16: 46,464,145	S59T	probably benign	Het
Nelfb	A	T	2: 25,203,888	M11K	probably damaging	Het
Nrp1	A	G	8: 128,476,169	N545S	probably damaging	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1333	T	C	4: 118,830,281	D53G	probably damaging	Het
Olfr1472	A	T	19: 13,453,960	S186T	possibly damaging	Het
Olfr492	T	A	7: 108,323,047	T210S	probably benign	Het
Olfr66	T	A	7: 103,881,700	D181V	probably damaging	Het
Olfr814	A	T	10: 129,874,521	F79I	probably damaging	Het
Olfr968	T	C	9: 39,772,540	T87A	probably benign	Het
P3h1	A	G	4: 119,246,665	H587R	probably damaging	Het
Paqr4	A	G	17: 23,739,858		probably null	Het
Pde12	A	G	14: 26,669,098	V152A	probably benign	Het
Ppip5k1	C	A	2: 121,350,491	E45*	probably null	Het
Ptch2	C	T	4: 117,110,057	A677V	probably benign	Het
Rgs12	A	G	5: 35,020,345	N93S	probably damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Robo4	A	G	9: 37,411,400	I850V	probably damaging	Het
Scap	T	A	9: 110,381,151	I876N	probably damaging	Het
Sin3a	A	G	9: 57,127,200	D1219G	possibly damaging	Het
Skint5	T	C	4: 113,885,808	E354G	unknown	Het
Spg20	A	G	3: 55,126,541	D396G	probably benign	Het
Spindoc	G	A	19: 7,373,659	S311L	probably benign	Het
Spta1	G	T	1: 174,223,328	R1791L	probably damaging	Het
Tbck	T	C	3: 132,801,517	I750T	possibly damaging	Het
Tcrg-V1	A	T	13: 19,340,304	Y66F	probably benign	Het
Tmem191c	T	C	16: 17,276,470		probably null	Het
Vmn2r125	A	G	4: 156,349,997	Y26C	probably damaging	Het
Zbtb17	T	C	4: 141,464,817	C358R	possibly damaging	Het
Zfp180	G	A	7: 24,105,434	G426E	probably damaging	Het
Zfp445	A	G	9: 122,853,886	V330A	probably benign	Het
Zfp595	A	G	13: 67,317,624	C192R	probably damaging	Het
Zkscan4	A	G	13: 21,484,453	H387R	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTGCATCCAATGAGATTATTTCT -3'
(R):5'- TGGCAGATGTGTCCTACCTGG -3'

Sequencing Primer
(F):5'- CTAGAACTTTTGTCAGAGTCCCAGG -3'
(R):5'- AGATGTGTCCTACCTGGTGAATCAC -3'

Posted On

2017-06-26