Incidental Mutation 'R5987:Mertk'
ID481700
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5987 (G1)
Quality Score220.009
Status Not validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128771374 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 437 (N437D)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
Predicted Effect probably benign
Transcript: ENSMUST00000014505
AA Change: N437D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: N437D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140221
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
Bloc1s1 T G 10: 128,923,386 K17T probably damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah12 C A 14: 26,886,871 D3872E possibly damaging Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Epor T C 9: 21,962,276 D59G possibly damaging Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Fam135b A G 15: 71,490,848 V228A probably benign Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gcc2 G T 10: 58,255,847 probably benign Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Robo4 A G 9: 37,411,400 I850V probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R7966:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGGCCCTGTGAAGAAG -3'
(R):5'- TGTCAATCAGCCACCCTTGC -3'

Sequencing Primer
(F):5'- GGAACTTTGTGGAAACATGACCTCTG -3'
(R):5'- TCCCACTTAGGCAGTCTGAG -3'
Posted On2017-06-26