Incidental Mutation 'R0515:Sox13'
ID48173
Institutional Source Beutler Lab
Gene Symbol Sox13
Ensembl Gene ENSMUSG00000070643
Gene NameSRY (sex determining region Y)-box 13
Synonyms
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0515 (G1)
Quality Score132
Status Validated
Chromosome1
Chromosomal Location133382303-133424377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133383719 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 592 (Y592N)
Ref Sequence ENSEMBL: ENSMUSP00000119729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094551] [ENSMUST00000129213] [ENSMUST00000135222] [ENSMUST00000144386] [ENSMUST00000153799]
Predicted Effect probably damaging
Transcript: ENSMUST00000094551
AA Change: Y592N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092130
Gene: ENSMUSG00000070643
AA Change: Y592N

DomainStartEndE-ValueType
coiled coil region 171 217 N/A INTRINSIC
HMG 415 485 3.09e-27 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126530
Predicted Effect probably benign
Transcript: ENSMUST00000129213
SMART Domains Protein: ENSMUSP00000122244
Gene: ENSMUSG00000070644

DomainStartEndE-ValueType
Pfam:Choline_kinase 1 200 4.7e-64 PFAM
Pfam:APH 2 227 2.2e-21 PFAM
Pfam:EcKinase 58 211 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135222
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144386
SMART Domains Protein: ENSMUSP00000122980
Gene: ENSMUSG00000070643

DomainStartEndE-ValueType
coiled coil region 153 197 N/A INTRINSIC
HMG 396 466 3.09e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145922
Predicted Effect probably damaging
Transcript: ENSMUST00000153799
AA Change: Y592N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119729
Gene: ENSMUSG00000070643
AA Change: Y592N

DomainStartEndE-ValueType
coiled coil region 153 199 N/A INTRINSIC
HMG 397 467 3.09e-27 SMART
low complexity region 575 589 N/A INTRINSIC
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. It has also been determined to be a type-1 diabetes autoantigen, also known as islet cell antibody 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired development of gamma-delta T cells and severe postnatal growth defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Hvcn1 A G 5: 122,233,519 N41D probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Sox13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sox13 APN 1 133387106 missense probably benign 0.02
IGL01147:Sox13 APN 1 133393135 missense probably benign
IGL01586:Sox13 APN 1 133389444 missense possibly damaging 0.70
IGL02750:Sox13 APN 1 133383796 missense probably benign 0.17
IGL02902:Sox13 APN 1 133389466 missense probably damaging 1.00
IGL03388:Sox13 APN 1 133388948 missense probably damaging 0.99
PIT4802001:Sox13 UTSW 1 133386258 missense probably damaging 1.00
R1328:Sox13 UTSW 1 133383817 missense probably damaging 0.99
R3766:Sox13 UTSW 1 133390798 missense possibly damaging 0.92
R4591:Sox13 UTSW 1 133383683 missense probably damaging 1.00
R4613:Sox13 UTSW 1 133388934 missense probably benign 0.29
R5715:Sox13 UTSW 1 133386183 critical splice donor site probably null
R5909:Sox13 UTSW 1 133383889 missense probably benign 0.04
R6155:Sox13 UTSW 1 133393267 missense probably damaging 1.00
R7150:Sox13 UTSW 1 133385505 missense possibly damaging 0.89
R7225:Sox13 UTSW 1 133387124 missense probably benign 0.10
R7232:Sox13 UTSW 1 133384391 intron probably null
R7443:Sox13 UTSW 1 133384573 missense probably damaging 1.00
R7443:Sox13 UTSW 1 133384631 missense probably damaging 1.00
X0021:Sox13 UTSW 1 133385998 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGCAGTTTCACCCATCACCTG -3'
(R):5'- GGAAGGCCCCTTATTTGACCATGAC -3'

Sequencing Primer
(F):5'- CGGATGGGAACAAGGTCTTT -3'
(R):5'- TATTTGACCATGACAGGCACTAGG -3'
Posted On2013-06-12