Incidental Mutation 'R0515:Mapk8ip1'
ID 48174
Institutional Source Beutler Lab
Gene Symbol Mapk8ip1
Ensembl Gene ENSMUSG00000027223
Gene Name mitogen-activated protein kinase 8 interacting protein 1
Synonyms Skip, IB1, Prkm8ip, MAPK8IP1, mjip-2a, JIP-1, Jip1
MMRRC Submission 038709-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.296) question?
Stock # R0515 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 92214021-92231608 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92217701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 198 (I198N)
Ref Sequence ENSEMBL: ENSMUSP00000106910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050312] [ENSMUST00000054316] [ENSMUST00000111279] [ENSMUST00000111280] [ENSMUST00000191292]
AlphaFold Q9WVI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000050312
AA Change: I207N

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050773
Gene: ENSMUSG00000027223
AA Change: I207N

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
SH3 487 544 2.62e-11 SMART
PTB 558 700 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054316
SMART Domains Protein: ENSMUSP00000051464
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
Pfam:DUF4733 4 97 7.7e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111279
AA Change: I198N

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106910
Gene: ENSMUSG00000027223
AA Change: I198N

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 62 78 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
low complexity region 233 245 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
SH3 478 535 2.62e-11 SMART
PTB 549 691 1.2e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111280
SMART Domains Protein: ENSMUSP00000106911
Gene: ENSMUSG00000044916

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189714
Predicted Effect probably benign
Transcript: ENSMUST00000191292
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of the pancreatic beta-cell function. It is highly similar to JIP-1, a mouse protein known to be a regulator of c-Jun amino-terminal kinase (Mapk8). This protein has been shown to prevent MAPK8 mediated activation of transcription factors, and to decrease IL-1 beta and MAP kinase kinase 1 (MEKK1) induced apoptosis in pancreatic beta cells. This protein also functions as a DNA-binding transactivator of the glucose transporter GLUT2. RE1-silencing transcription factor (REST) is reported to repress the expression of this gene in insulin-secreting beta cells. This gene is found to be mutated in a type 2 diabetes family, and thus is thought to be a susceptibility gene for type 2 diabetes. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutation of this gene results in a decreased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
App C T 16: 84,900,232 (GRCm39) probably benign Het
Arhgap11a G A 2: 113,667,816 (GRCm39) T395I possibly damaging Het
Arhgef38 T G 3: 132,855,301 (GRCm39) H262P probably damaging Het
Cd96 A G 16: 45,884,268 (GRCm39) probably benign Het
Cfap57 A G 4: 118,477,599 (GRCm39) S2P probably damaging Het
Cltc A G 11: 86,599,865 (GRCm39) S948P probably benign Het
Cyp3a41a A T 5: 145,654,810 (GRCm39) H30Q probably damaging Het
Dcp2 C T 18: 44,532,798 (GRCm39) L105F probably benign Het
Dennd4c T C 4: 86,731,703 (GRCm39) V887A possibly damaging Het
Dnaaf9 A G 2: 130,582,408 (GRCm39) V515A probably damaging Het
Gm11360 T A 13: 28,140,143 (GRCm39) D2E probably damaging Het
Gpank1 G T 17: 35,342,475 (GRCm39) A149S probably damaging Het
Gtf2i C A 5: 134,271,773 (GRCm39) S792I probably damaging Het
Hvcn1 A G 5: 122,371,582 (GRCm39) N41D probably damaging Het
Klk1b5 A G 7: 43,867,957 (GRCm39) Y43C probably damaging Het
Lmtk2 A G 5: 144,111,809 (GRCm39) D843G possibly damaging Het
Lrriq1 A T 10: 102,904,829 (GRCm39) probably null Het
Mill1 T C 7: 17,998,798 (GRCm39) V336A probably benign Het
Mroh7 T A 4: 106,548,861 (GRCm39) M1001L probably benign Het
Nfe2 T A 15: 103,157,854 (GRCm39) T46S probably null Het
Or8b40 T C 9: 38,027,313 (GRCm39) S74P probably damaging Het
Or9q1 T C 19: 13,805,185 (GRCm39) S192G probably damaging Het
Parp4 T C 14: 56,851,124 (GRCm39) V709A probably damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Prex2 A T 1: 11,270,098 (GRCm39) Q1261L probably damaging Het
Prl8a8 T A 13: 27,692,350 (GRCm39) I214L probably damaging Het
Rictor C T 15: 6,798,782 (GRCm39) T343M probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Siglecf T C 7: 43,005,055 (GRCm39) probably null Het
Slco1b2 T C 6: 141,615,136 (GRCm39) F347S possibly damaging Het
Sox13 A T 1: 133,311,457 (GRCm39) Y592N probably damaging Het
Synj1 C T 16: 90,790,910 (GRCm39) A84T possibly damaging Het
Tent5b A T 4: 133,213,450 (GRCm39) H107L possibly damaging Het
Trpv5 T A 6: 41,651,145 (GRCm39) probably benign Het
Tshz1 A G 18: 84,034,090 (GRCm39) V106A probably benign Het
Other mutations in Mapk8ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Mapk8ip1 APN 2 92,215,533 (GRCm39) missense probably benign 0.06
IGL01538:Mapk8ip1 APN 2 92,219,319 (GRCm39) critical splice donor site probably null
IGL02089:Mapk8ip1 APN 2 92,216,220 (GRCm39) missense probably damaging 1.00
IGL02177:Mapk8ip1 APN 2 92,217,092 (GRCm39) missense probably damaging 1.00
IGL03032:Mapk8ip1 APN 2 92,216,958 (GRCm39) missense probably damaging 1.00
IGL03180:Mapk8ip1 APN 2 92,217,257 (GRCm39) missense possibly damaging 0.91
R0243:Mapk8ip1 UTSW 2 92,216,289 (GRCm39) missense probably damaging 1.00
R0483:Mapk8ip1 UTSW 2 92,216,321 (GRCm39) splice site probably null
R2016:Mapk8ip1 UTSW 2 92,221,379 (GRCm39) critical splice donor site probably null
R2017:Mapk8ip1 UTSW 2 92,221,379 (GRCm39) critical splice donor site probably null
R5141:Mapk8ip1 UTSW 2 92,217,110 (GRCm39) missense probably damaging 1.00
R5858:Mapk8ip1 UTSW 2 92,215,317 (GRCm39) missense probably damaging 1.00
R6194:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6243:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6244:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6245:Mapk8ip1 UTSW 2 92,219,589 (GRCm39) missense probably damaging 0.98
R6984:Mapk8ip1 UTSW 2 92,217,072 (GRCm39) missense probably damaging 1.00
R7471:Mapk8ip1 UTSW 2 92,219,489 (GRCm39) missense probably benign
R7588:Mapk8ip1 UTSW 2 92,216,984 (GRCm39) missense possibly damaging 0.77
R7810:Mapk8ip1 UTSW 2 92,219,496 (GRCm39) missense probably benign 0.05
R8021:Mapk8ip1 UTSW 2 92,216,760 (GRCm39) missense possibly damaging 0.91
R8975:Mapk8ip1 UTSW 2 92,215,166 (GRCm39) missense probably damaging 1.00
R9062:Mapk8ip1 UTSW 2 92,217,527 (GRCm39) missense probably damaging 1.00
R9267:Mapk8ip1 UTSW 2 92,216,714 (GRCm39) missense possibly damaging 0.46
R9306:Mapk8ip1 UTSW 2 92,219,428 (GRCm39) missense probably benign
R9569:Mapk8ip1 UTSW 2 92,217,599 (GRCm39) missense probably benign 0.00
R9729:Mapk8ip1 UTSW 2 92,217,060 (GRCm39) missense probably damaging 1.00
X0023:Mapk8ip1 UTSW 2 92,216,946 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACTTGACCGAGTCGTAGGACAGTG -3'
(R):5'- CATCCTCCCCTCTGAAGACAGGTAAG -3'

Sequencing Primer
(F):5'- CTGGATCGGAGCTAACTGACATC -3'
(R):5'- TCTCTCCCCAAGCTGGAGAC -3'
Posted On 2013-06-12