Incidental Mutation 'R5987:Robo4'
ID481740
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5987 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37411400 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 850 (I850V)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102895
AA Change: I843V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: I843V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115046
AA Change: I902V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: I902V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115048
AA Change: I739V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: I739V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Predicted Effect probably damaging
Transcript: ENSMUST00000214185
AA Change: I850V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215777
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
Bloc1s1 T G 10: 128,923,386 K17T probably damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah12 C A 14: 26,886,871 D3872E possibly damaging Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Epor T C 9: 21,962,276 D59G possibly damaging Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Fam135b A G 15: 71,490,848 V228A probably benign Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gcc2 G T 10: 58,255,847 probably benign Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mertk A G 2: 128,771,374 N437D probably benign Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5490:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R7922:Robo4 UTSW 9 37410759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGAGCCGAAACACTAC -3'
(R):5'- CACGAGCAAAGTGAGTATCAGC -3'

Sequencing Primer
(F):5'- CACTACAGCTAAGCATGCTAGGG -3'
(R):5'- AAGAGCTAACCAGGCTGGCC -3'
Posted On2017-06-26