Incidental Mutation 'R5987:Bloc1s1'
ID481747
Institutional Source Beutler Lab
Gene Symbol Bloc1s1
Ensembl Gene ENSMUSG00000090247
Gene Namebiogenesis of lysosomal organelles complex-1, subunit 1
SynonymsBLOS1, Gcn5l1
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5987 (G1)
Quality Score147.008
Status Not validated
Chromosome10
Chromosomal Location128917882-128924035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128923386 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 17 (K17T)
Ref Sequence ENSEMBL: ENSMUSP00000117408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026405] [ENSMUST00000026406] [ENSMUST00000131271] [ENSMUST00000135161] [ENSMUST00000145616] [ENSMUST00000149961] [ENSMUST00000153731]
Predicted Effect probably damaging
Transcript: ENSMUST00000026405
AA Change: K17T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026405
Gene: ENSMUSG00000090247
AA Change: K17T

DomainStartEndE-ValueType
Pfam:GCN5L1 5 125 3.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026406
SMART Domains Protein: ENSMUSP00000026406
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 194 3.6e-23 PFAM
Pfam:adh_short_C2 35 230 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131271
SMART Domains Protein: ENSMUSP00000114321
Gene: ENSMUSG00000090247

DomainStartEndE-ValueType
Pfam:GCN5L1 4 121 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135161
SMART Domains Protein: ENSMUSP00000115182
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
transmembrane domain 59 78 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143628
Predicted Effect probably benign
Transcript: ENSMUST00000145616
SMART Domains Protein: ENSMUSP00000123358
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 175 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149961
SMART Domains Protein: ENSMUSP00000123183
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
Pfam:adh_short 2 124 4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153731
AA Change: K17T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117408
Gene: ENSMUSG00000090247
AA Change: K17T

DomainStartEndE-ValueType
Pfam:GCN5L1 5 92 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153935
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BLOC1S1 is a component of the ubiquitously expressed BLOC1 multisubunit protein complex. BLOC1 is required for normal biogenesis of specialized organelles of the endosomal-lysosomal system, such as melanosomes and platelet dense granules (Starcevic and Dell'Angelica, 2004 [PubMed 15102850]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic lethality. Mouse embryonic fibroblasts show alterations in autophagy, mitochondrial physiology, and vesicle-mediated transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah12 C A 14: 26,886,871 D3872E possibly damaging Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Epor T C 9: 21,962,276 D59G possibly damaging Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Fam135b A G 15: 71,490,848 V228A probably benign Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gcc2 G T 10: 58,255,847 probably benign Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mertk A G 2: 128,771,374 N437D probably benign Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Robo4 A G 9: 37,411,400 I850V probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Bloc1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Bloc1s1 APN 10 128922648 splice site probably benign
R4702:Bloc1s1 UTSW 10 128923398 missense probably damaging 1.00
R5375:Bloc1s1 UTSW 10 128923957 unclassified probably benign
R7108:Bloc1s1 UTSW 10 128922723 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACGGAGTTTCCAGAAGTGCC -3'
(R):5'- ACTGAGCCTCATTAGCGAACAG -3'

Sequencing Primer
(F):5'- GAAGTGCCGCCCCCAATTC -3'
(R):5'- CAAAAGCAGAGGGAGGCTCTTG -3'
Posted On2017-06-26