Mutagenetix > Incidental Mutations

Incidental Mutation 'R5987:Mast4'

481758

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

044167-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Is this an essential gene?

Possibly essential (E-score: 0.505) question?

Stock #

R5987 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102758734 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 760 (Q760H)

Ref Sequence

ENSEMBL: ENSMUSP00000131651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]

Predicted Effect

probably benign
Transcript: ENSMUST00000099202
AA Change: Q775H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: Q775H

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726
AA Change: Q952H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: Q952H

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058
AA Change: Q952H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: Q952H

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462
AA Change: Q760H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: Q760H

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171722

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: Q760H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: Q760H

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172264
AA Change: Q748H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: Q748H

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: Q784H

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	C	1: 71,258,098	L2411R	probably damaging	Het
Als2	A	G	1: 59,206,587	W577R	probably damaging	Het
Aox2	C	A	1: 58,307,359	R551S	probably benign	Het
Areg	A	T	5: 91,146,718	H245L	possibly damaging	Het
Arhgap35	T	C	7: 16,563,467	T558A	possibly damaging	Het
Arhgef28	A	T	13: 97,936,860	C1322*	probably null	Het
Arhgef38	T	C	3: 133,206,958	R107G	possibly damaging	Het
Atf7ip	T	A	6: 136,571,502	F695L	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Bche	T	G	3: 73,648,678	Q549P	possibly damaging	Het
Blnk	A	G	19: 40,929,289	F417L	possibly damaging	Het
Bloc1s1	T	G	10: 128,923,386	K17T	probably damaging	Het
C330018D20Rik	G	T	18: 56,957,896	T65K	probably damaging	Het
Cers1	T	A	8: 70,321,578	S162T	possibly damaging	Het
Cgn	T	C	3: 94,779,522	K157E	probably benign	Het
Cldn7	G	A	11: 69,967,668	R196Q	probably benign	Het
Clrn2	C	A	5: 45,454,027	Q73K	probably benign	Het
Cmss1	A	G	16: 57,302,245	V262A	probably benign	Het
Cpb2	T	A	14: 75,260,688	V97E	probably damaging	Het
Ctnnd2	G	A	15: 30,683,241	V463I	probably benign	Het
Cyp7a1	A	T	4: 6,268,476	S416R	probably benign	Het
Dip2b	C	T	15: 100,190,079	R965C	probably damaging	Het
Dkk3	T	C	7: 112,150,658	T102A	probably benign	Het
Dmap1	C	A	4: 117,680,842		probably null	Het
Dnah12	C	A	14: 26,886,871	D3872E	possibly damaging	Het
Dnah7b	A	G	1: 46,119,398		probably null	Het
Dnaic1	C	T	4: 41,632,391	T575I	probably benign	Het
Dsg1a	T	A	18: 20,331,542	Y365N	probably damaging	Het
Dusp11	T	A	6: 85,959,233	K18*	probably null	Het
E2f2	A	T	4: 136,172,934	T52S	probably benign	Het
Elavl4	A	G	4: 110,290,644	L13S	probably benign	Het
Epor	T	C	9: 21,962,276	D59G	possibly damaging	Het
Eral1	A	G	11: 78,080,233	C43R	possibly damaging	Het
Fam135b	A	G	15: 71,490,848	V228A	probably benign	Het
Gba	T	C	3: 89,205,822	S187P	probably damaging	Het
Gcc2	G	T	10: 58,255,847		probably benign	Het
Gdap2	C	A	3: 100,202,256		probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm8251	A	T	1: 44,057,257	N1560K	probably benign	Het
Gpr160	T	C	3: 30,896,463	L228P	probably benign	Het
Gsdmc2	A	C	15: 63,830,866	V184G	probably benign	Het
Gtf2e2	A	T	8: 33,776,052	K252M	probably damaging	Het
Gtf2e2	G	T	8: 33,776,053	K252N	probably benign	Het
Gys1	T	C	7: 45,438,105	Y102H	probably benign	Het
Hist1h4b	A	G	13: 23,757,226	D69G	probably damaging	Het
Ifit3b	A	C	19: 34,612,198	D258A	probably damaging	Het
Itpr3	T	A	17: 27,104,601	M1200K	probably damaging	Het
Kcng4	A	T	8: 119,626,359	F271I	probably damaging	Het
Klhdc2	C	T	12: 69,303,613	S144L	possibly damaging	Het
Lhcgr	A	G	17: 88,755,578	F222S	probably damaging	Het
Lrp5	C	G	19: 3,628,299	G519R	probably damaging	Het
Magel2	T	C	7: 62,378,767	V473A	probably benign	Het
Map1a	T	C	2: 121,304,295	V1864A	possibly damaging	Het
Mertk	A	G	2: 128,771,374	N437D	probably benign	Het
Mettl18	G	A	1: 163,996,775	V222I	probably benign	Het
Mical2	C	T	7: 112,334,948	T782M	probably benign	Het
Mocos	T	A	18: 24,686,693	V664E	probably damaging	Het
Neb	G	T	2: 52,295,294	N975K	probably benign	Het
Nectin3	A	T	16: 46,464,145	S59T	probably benign	Het
Nelfb	A	T	2: 25,203,888	M11K	probably damaging	Het
Nrp1	A	G	8: 128,476,169	N545S	probably damaging	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1333	T	C	4: 118,830,281	D53G	probably damaging	Het
Olfr1472	A	T	19: 13,453,960	S186T	possibly damaging	Het
Olfr492	T	A	7: 108,323,047	T210S	probably benign	Het
Olfr66	T	A	7: 103,881,700	D181V	probably damaging	Het
Olfr814	A	T	10: 129,874,521	F79I	probably damaging	Het
Olfr968	T	C	9: 39,772,540	T87A	probably benign	Het
P3h1	A	G	4: 119,246,665	H587R	probably damaging	Het
Paqr4	A	G	17: 23,739,858		probably null	Het
Pde12	A	G	14: 26,669,098	V152A	probably benign	Het
Ppip5k1	C	A	2: 121,350,491	E45*	probably null	Het
Ptch2	C	T	4: 117,110,057	A677V	probably benign	Het
Rgs12	A	G	5: 35,020,345	N93S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Robo4	A	G	9: 37,411,400	I850V	probably damaging	Het
Scap	T	A	9: 110,381,151	I876N	probably damaging	Het
Sin3a	A	G	9: 57,127,200	D1219G	possibly damaging	Het
Skint5	T	C	4: 113,885,808	E354G	unknown	Het
Spg20	A	G	3: 55,126,541	D396G	probably benign	Het
Spindoc	G	A	19: 7,373,659	S311L	probably benign	Het
Spta1	G	T	1: 174,223,328	R1791L	probably damaging	Het
Tbck	T	C	3: 132,801,517	I750T	possibly damaging	Het
Tcrg-V1	A	T	13: 19,340,304	Y66F	probably benign	Het
Tmem191c	T	C	16: 17,276,470		probably null	Het
Vmn2r125	A	G	4: 156,349,997	Y26C	probably damaging	Het
Zbtb17	T	C	4: 141,464,817	C358R	possibly damaging	Het
Zfp180	G	A	7: 24,105,434	G426E	probably damaging	Het
Zfp445	A	G	9: 122,853,886	V330A	probably benign	Het
Zfp595	A	G	13: 67,317,624	C192R	probably damaging	Het
Zkscan4	A	G	13: 21,484,453	H387R	probably damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7957:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTTACCTGACAGTGTGG -3'
(R):5'- TAAACAGTGTGTGCTGGGGC -3'

Sequencing Primer
(F):5'- GGGCTCCTCCTGAGTACACTC -3'
(R):5'- ACAGCATAGATGTCCTTCCATG -3'

Posted On

2017-06-26