Mutagenetix > Incidental Mutations

Incidental Mutation 'R5987:Mast4'

481758

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

044167-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R5987 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102758734 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 760 (Q760H)

Ref Sequence

ENSEMBL: ENSMUSP00000131651 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]

Predicted Effect

probably benign
Transcript: ENSMUST00000099202
AA Change: Q775H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: Q775H

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726
AA Change: Q952H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: Q952H

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058
AA Change: Q952H

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: Q952H

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462
AA Change: Q760H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: Q760H

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171722

Predicted Effect

probably damaging
Transcript: ENSMUST00000171791
AA Change: Q760H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: Q760H

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172264
AA Change: Q748H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751
AA Change: Q748H

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000194446
AA Change: Q784H

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	C	1: 71,258,098	L2411R	probably damaging	Het
Als2	A	G	1: 59,206,587	W577R	probably damaging	Het
Aox2	C	A	1: 58,307,359	R551S	probably benign	Het
Areg	A	T	5: 91,146,718	H245L	possibly damaging	Het
Arhgap35	T	C	7: 16,563,467	T558A	possibly damaging	Het
Arhgef28	A	T	13: 97,936,860	C1322*	probably null	Het
Arhgef38	T	C	3: 133,206,958	R107G	possibly damaging	Het
Atf7ip	T	A	6: 136,571,502	F695L	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Bche	T	G	3: 73,648,678	Q549P	possibly damaging	Het
Blnk	A	G	19: 40,929,289	F417L	possibly damaging	Het
Bloc1s1	T	G	10: 128,923,386	K17T	probably damaging	Het
C330018D20Rik	G	T	18: 56,957,896	T65K	probably damaging	Het
Cers1	T	A	8: 70,321,578	S162T	possibly damaging	Het
Cgn	T	C	3: 94,779,522	K157E	probably benign	Het
Cldn7	G	A	11: 69,967,668	R196Q	probably benign	Het
Clrn2	C	A	5: 45,454,027	Q73K	probably benign	Het
Cmss1	A	G	16: 57,302,245	V262A	probably benign	Het
Cpb2	T	A	14: 75,260,688	V97E	probably damaging	Het
Ctnnd2	G	A	15: 30,683,241	V463I	probably benign	Het
Cyp7a1	A	T	4: 6,268,476	S416R	probably benign	Het
Dip2b	C	T	15: 100,190,079	R965C	probably damaging	Het
Dkk3	T	C	7: 112,150,658	T102A	probably benign	Het
Dmap1	C	A	4: 117,680,842		probably null	Het
Dnah12	C	A	14: 26,886,871	D3872E	possibly damaging	Het
Dnah7b	A	G	1: 46,119,398		probably null	Het
Dnaic1	C	T	4: 41,632,391	T575I	probably benign	Het
Dsg1a	T	A	18: 20,331,542	Y365N	probably damaging	Het
Dusp11	T	A	6: 85,959,233	K18*	probably null	Het
E2f2	A	T	4: 136,172,934	T52S	probably benign	Het
Elavl4	A	G	4: 110,290,644	L13S	probably benign	Het
Epor	T	C	9: 21,962,276	D59G	possibly damaging	Het
Eral1	A	G	11: 78,080,233	C43R	possibly damaging	Het
Fam135b	A	G	15: 71,490,848	V228A	probably benign	Het
Gba	T	C	3: 89,205,822	S187P	probably damaging	Het
Gcc2	G	T	10: 58,255,847		probably benign	Het
Gdap2	C	A	3: 100,202,256		probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm8251	A	T	1: 44,057,257	N1560K	probably benign	Het
Gpr160	T	C	3: 30,896,463	L228P	probably benign	Het
Gsdmc2	A	C	15: 63,830,866	V184G	probably benign	Het
Gtf2e2	A	T	8: 33,776,052	K252M	probably damaging	Het
Gtf2e2	G	T	8: 33,776,053	K252N	probably benign	Het
Gys1	T	C	7: 45,438,105	Y102H	probably benign	Het
Hist1h4b	A	G	13: 23,757,226	D69G	probably damaging	Het
Ifit3b	A	C	19: 34,612,198	D258A	probably damaging	Het
Itpr3	T	A	17: 27,104,601	M1200K	probably damaging	Het
Kcng4	A	T	8: 119,626,359	F271I	probably damaging	Het
Klhdc2	C	T	12: 69,303,613	S144L	possibly damaging	Het
Lhcgr	A	G	17: 88,755,578	F222S	probably damaging	Het
Lrp5	C	G	19: 3,628,299	G519R	probably damaging	Het
Magel2	T	C	7: 62,378,767	V473A	probably benign	Het
Map1a	T	C	2: 121,304,295	V1864A	possibly damaging	Het
Mertk	A	G	2: 128,771,374	N437D	probably benign	Het
Mettl18	G	A	1: 163,996,775	V222I	probably benign	Het
Mical2	C	T	7: 112,334,948	T782M	probably benign	Het
Mocos	T	A	18: 24,686,693	V664E	probably damaging	Het
Neb	G	T	2: 52,295,294	N975K	probably benign	Het
Nectin3	A	T	16: 46,464,145	S59T	probably benign	Het
Nelfb	A	T	2: 25,203,888	M11K	probably damaging	Het
Nrp1	A	G	8: 128,476,169	N545S	probably damaging	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1333	T	C	4: 118,830,281	D53G	probably damaging	Het
Olfr1472	A	T	19: 13,453,960	S186T	possibly damaging	Het
Olfr492	T	A	7: 108,323,047	T210S	probably benign	Het
Olfr66	T	A	7: 103,881,700	D181V	probably damaging	Het
Olfr814	A	T	10: 129,874,521	F79I	probably damaging	Het
Olfr968	T	C	9: 39,772,540	T87A	probably benign	Het
P3h1	A	G	4: 119,246,665	H587R	probably damaging	Het
Paqr4	A	G	17: 23,739,858		probably null	Het
Pde12	A	G	14: 26,669,098	V152A	probably benign	Het
Ppip5k1	C	A	2: 121,350,491	E45*	probably null	Het
Ptch2	C	T	4: 117,110,057	A677V	probably benign	Het
Rgs12	A	G	5: 35,020,345	N93S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Robo4	A	G	9: 37,411,400	I850V	probably damaging	Het
Scap	T	A	9: 110,381,151	I876N	probably damaging	Het
Sin3a	A	G	9: 57,127,200	D1219G	possibly damaging	Het
Skint5	T	C	4: 113,885,808	E354G	unknown	Het
Spg20	A	G	3: 55,126,541	D396G	probably benign	Het
Spindoc	G	A	19: 7,373,659	S311L	probably benign	Het
Spta1	G	T	1: 174,223,328	R1791L	probably damaging	Het
Tbck	T	C	3: 132,801,517	I750T	possibly damaging	Het
Tcrg-V1	A	T	13: 19,340,304	Y66F	probably benign	Het
Tmem191c	T	C	16: 17,276,470		probably null	Het
Vmn2r125	A	G	4: 156,349,997	Y26C	probably damaging	Het
Zbtb17	T	C	4: 141,464,817	C358R	possibly damaging	Het
Zfp180	G	A	7: 24,105,434	G426E	probably damaging	Het
Zfp445	A	G	9: 122,853,886	V330A	probably benign	Het
Zfp595	A	G	13: 67,317,624	C192R	probably damaging	Het
Zkscan4	A	G	13: 21,484,453	H387R	probably damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
skinnybones	UTSW	13	102804641	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0646:Mast4	UTSW	13	102758744	splice site	probably benign
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	102953125	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102735739	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102738721	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102751478	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102761392	missense	probably damaging	1.00
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTTACCTGACAGTGTGG -3'
(R):5'- TAAACAGTGTGTGCTGGGGC -3'

Sequencing Primer
(F):5'- GGGCTCCTCCTGAGTACACTC -3'
(R):5'- ACAGCATAGATGTCCTTCCATG -3'

Posted On

2017-06-26