Incidental Mutation 'R5987:Dnah12'
ID481760
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R5987 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26886871 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3872 (D3872E)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022433
AA Change: D3872E

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: D3872E

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165269
AA Change: D1252E

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130609
Gene: ENSMUSG00000021879
AA Change: D1252E

DomainStartEndE-ValueType
Pfam:MT 1 248 5.7e-40 PFAM
Pfam:AAA_9 270 495 3.8e-96 PFAM
low complexity region 593 606 N/A INTRINSIC
Pfam:Dynein_heavy 631 1336 2e-287 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
Bloc1s1 T G 10: 128,923,386 K17T probably damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Epor T C 9: 21,962,276 D59G possibly damaging Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Fam135b A G 15: 71,490,848 V228A probably benign Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gcc2 G T 10: 58,255,847 probably benign Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mertk A G 2: 128,771,374 N437D probably benign Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Robo4 A G 9: 37,411,400 I850V probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26796219 missense probably benign 0.01
R7855:Dnah12 UTSW 14 26829329 missense probably benign 0.14
R7870:Dnah12 UTSW 14 26856529 missense probably benign 0.00
R7920:Dnah12 UTSW 14 26796219 missense probably benign 0.01
R7938:Dnah12 UTSW 14 26829329 missense probably benign 0.14
R7953:Dnah12 UTSW 14 26856529 missense probably benign 0.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26875215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTATCCACCAGAGTTTTC -3'
(R):5'- AGTCCTACACATTACAAGATGGTGAG -3'

Sequencing Primer
(F):5'- CCAGAGTTTTCCTCATGAGATGAAGG -3'
(R):5'- GCAGAAGCCGGAGAACAATCTC -3'
Posted On2017-06-26