Incidental Mutation 'R5987:Fam135b'
ID481764
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5987 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71490848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably benign
Transcript: ENSMUST00000022953
AA Change: V228A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: V228A

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230569
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
Bloc1s1 T G 10: 128,923,386 K17T probably damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah12 C A 14: 26,886,871 D3872E possibly damaging Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Epor T C 9: 21,962,276 D59G possibly damaging Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gcc2 G T 10: 58,255,847 probably benign Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mertk A G 2: 128,771,374 N437D probably benign Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Robo4 A G 9: 37,411,400 I850V probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R7949:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- AGGAATGTCAGCTCCTGGAAG -3'
(R):5'- AGTGGCATGGCATGACGATG -3'

Sequencing Primer
(F):5'- AGGAGACTTCTCTGCTCCTATC -3'
(R):5'- CATGGCATGACGATGGTTTTTCC -3'
Posted On2017-06-26