Mutagenetix > Incidental Mutation

Incidental Mutation 'R5987:Dip2b'

481765

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

044167-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.705) question?

Stock #

R5987 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 100190079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 965 (R965C)

Ref Sequence

ENSEMBL: ENSMUSP00000097777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]

AlphaFold

Q3UH60

Predicted Effect

probably damaging
Transcript: ENSMUST00000023768
AA Change: R731C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: R731C

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100203
AA Change: R965C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: R965C

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108971
AA Change: R731C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: R731C

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	583	9.5e-26	PFAM
Pfam:AMP-binding	759	1234	1.2e-52	PFAM
low complexity region	1298	1310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229080

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	C	1: 71,258,098	L2411R	probably damaging	Het
Als2	A	G	1: 59,206,587	W577R	probably damaging	Het
Aox2	C	A	1: 58,307,359	R551S	probably benign	Het
Areg	A	T	5: 91,146,718	H245L	possibly damaging	Het
Arhgap35	T	C	7: 16,563,467	T558A	possibly damaging	Het
Arhgef28	A	T	13: 97,936,860	C1322*	probably null	Het
Arhgef38	T	C	3: 133,206,958	R107G	possibly damaging	Het
Atf7ip	T	A	6: 136,571,502	F695L	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Bche	T	G	3: 73,648,678	Q549P	possibly damaging	Het
Blnk	A	G	19: 40,929,289	F417L	possibly damaging	Het
Bloc1s1	T	G	10: 128,923,386	K17T	probably damaging	Het
C330018D20Rik	G	T	18: 56,957,896	T65K	probably damaging	Het
Cers1	T	A	8: 70,321,578	S162T	possibly damaging	Het
Cgn	T	C	3: 94,779,522	K157E	probably benign	Het
Cldn7	G	A	11: 69,967,668	R196Q	probably benign	Het
Clrn2	C	A	5: 45,454,027	Q73K	probably benign	Het
Cmss1	A	G	16: 57,302,245	V262A	probably benign	Het
Cpb2	T	A	14: 75,260,688	V97E	probably damaging	Het
Ctnnd2	G	A	15: 30,683,241	V463I	probably benign	Het
Cyp7a1	A	T	4: 6,268,476	S416R	probably benign	Het
Dkk3	T	C	7: 112,150,658	T102A	probably benign	Het
Dmap1	C	A	4: 117,680,842		probably null	Het
Dnah12	C	A	14: 26,886,871	D3872E	possibly damaging	Het
Dnah7b	A	G	1: 46,119,398		probably null	Het
Dnaic1	C	T	4: 41,632,391	T575I	probably benign	Het
Dsg1a	T	A	18: 20,331,542	Y365N	probably damaging	Het
Dusp11	T	A	6: 85,959,233	K18*	probably null	Het
E2f2	A	T	4: 136,172,934	T52S	probably benign	Het
Elavl4	A	G	4: 110,290,644	L13S	probably benign	Het
Epor	T	C	9: 21,962,276	D59G	possibly damaging	Het
Eral1	A	G	11: 78,080,233	C43R	possibly damaging	Het
Fam135b	A	G	15: 71,490,848	V228A	probably benign	Het
Gba	T	C	3: 89,205,822	S187P	probably damaging	Het
Gcc2	G	T	10: 58,255,847		probably benign	Het
Gdap2	C	A	3: 100,202,256		probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm8251	A	T	1: 44,057,257	N1560K	probably benign	Het
Gpr160	T	C	3: 30,896,463	L228P	probably benign	Het
Gsdmc2	A	C	15: 63,830,866	V184G	probably benign	Het
Gtf2e2	A	T	8: 33,776,052	K252M	probably damaging	Het
Gtf2e2	G	T	8: 33,776,053	K252N	probably benign	Het
Gys1	T	C	7: 45,438,105	Y102H	probably benign	Het
Hist1h4b	A	G	13: 23,757,226	D69G	probably damaging	Het
Ifit3b	A	C	19: 34,612,198	D258A	probably damaging	Het
Itpr3	T	A	17: 27,104,601	M1200K	probably damaging	Het
Kcng4	A	T	8: 119,626,359	F271I	probably damaging	Het
Klhdc2	C	T	12: 69,303,613	S144L	possibly damaging	Het
Lhcgr	A	G	17: 88,755,578	F222S	probably damaging	Het
Lrp5	C	G	19: 3,628,299	G519R	probably damaging	Het
Magel2	T	C	7: 62,378,767	V473A	probably benign	Het
Map1a	T	C	2: 121,304,295	V1864A	possibly damaging	Het
Mast4	T	A	13: 102,758,734	Q760H	probably damaging	Het
Mertk	A	G	2: 128,771,374	N437D	probably benign	Het
Mettl18	G	A	1: 163,996,775	V222I	probably benign	Het
Mical2	C	T	7: 112,334,948	T782M	probably benign	Het
Mocos	T	A	18: 24,686,693	V664E	probably damaging	Het
Neb	G	T	2: 52,295,294	N975K	probably benign	Het
Nectin3	A	T	16: 46,464,145	S59T	probably benign	Het
Nelfb	A	T	2: 25,203,888	M11K	probably damaging	Het
Nrp1	A	G	8: 128,476,169	N545S	probably damaging	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1333	T	C	4: 118,830,281	D53G	probably damaging	Het
Olfr1472	A	T	19: 13,453,960	S186T	possibly damaging	Het
Olfr492	T	A	7: 108,323,047	T210S	probably benign	Het
Olfr66	T	A	7: 103,881,700	D181V	probably damaging	Het
Olfr814	A	T	10: 129,874,521	F79I	probably damaging	Het
Olfr968	T	C	9: 39,772,540	T87A	probably benign	Het
P3h1	A	G	4: 119,246,665	H587R	probably damaging	Het
Paqr4	A	G	17: 23,739,858		probably null	Het
Pde12	A	G	14: 26,669,098	V152A	probably benign	Het
Ppip5k1	C	A	2: 121,350,491	E45*	probably null	Het
Ptch2	C	T	4: 117,110,057	A677V	probably benign	Het
Rgs12	A	G	5: 35,020,345	N93S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Robo4	A	G	9: 37,411,400	I850V	probably damaging	Het
Scap	T	A	9: 110,381,151	I876N	probably damaging	Het
Sin3a	A	G	9: 57,127,200	D1219G	possibly damaging	Het
Skint5	T	C	4: 113,885,808	E354G	unknown	Het
Spg20	A	G	3: 55,126,541	D396G	probably benign	Het
Spindoc	G	A	19: 7,373,659	S311L	probably benign	Het
Spta1	G	T	1: 174,223,328	R1791L	probably damaging	Het
Tbck	T	C	3: 132,801,517	I750T	possibly damaging	Het
Tcrg-V1	A	T	13: 19,340,304	Y66F	probably benign	Het
Tmem191c	T	C	16: 17,276,470		probably null	Het
Vmn2r125	A	G	4: 156,349,997	Y26C	probably damaging	Het
Zbtb17	T	C	4: 141,464,817	C358R	possibly damaging	Het
Zfp180	G	A	7: 24,105,434	G426E	probably damaging	Het
Zfp445	A	G	9: 122,853,886	V330A	probably benign	Het
Zfp595	A	G	13: 67,317,624	C192R	probably damaging	Het
Zkscan4	A	G	13: 21,484,453	H387R	probably damaging	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
R9289:Dip2b	UTSW	15	100173271	missense	probably damaging	0.97
R9405:Dip2b	UTSW	15	100195876	missense	probably benign	0.05
R9477:Dip2b	UTSW	15	100038903	missense	probably damaging	1.00
R9485:Dip2b	UTSW	15	100155043	missense	probably benign	0.05
R9533:Dip2b	UTSW	15	100175297	missense	probably benign	0.06
R9581:Dip2b	UTSW	15	100181374	missense	probably damaging	0.99
R9666:Dip2b	UTSW	15	100209580	missense	probably damaging	1.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCACAGTGTGTACATATTGG -3'
(R):5'- CTGCAAAATCTCTGCCAGGAAC -3'

Sequencing Primer
(F):5'- GTACATATTGGTACCTTTTTCACTGG -3'
(R):5'- TGGTGCTAAAATCACAACGCAG -3'

Posted On

2017-06-26