Mutagenetix > Incidental Mutation

Incidental Mutation 'R5987:Dsg1a'

481773

Institutional Source

Beutler Lab

Gene Symbol

Dsg1a

Ensembl Gene

ENSMUSG00000069441

Gene Name

desmoglein 1 alpha

Synonyms

Dsg1

MMRRC Submission

044167-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R5987 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20310811-20343350 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20331542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 365 (Y365N)

Ref Sequence

ENSEMBL: ENSMUSP00000076393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077146]

AlphaFold

Q61495

Predicted Effect

probably damaging
Transcript: ENSMUST00000077146
AA Change: Y365N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076393
Gene: ENSMUSG00000069441
AA Change: Y365N

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.45e-14	SMART
CA	179	267	3.11e-21	SMART
CA	290	384	6.29e-8	SMART
CA	407	485	6.44e-1	SMART
low complexity region	573	584	N/A	INTRINSIC
low complexity region	590	598	N/A	INTRINSIC
Pfam:Cadherin_C	659	781	1.6e-10	PFAM
low complexity region	786	799	N/A	INTRINSIC
internal_repeat_1	823	888	9.56e-6	PROSPERO
internal_repeat_1	908	975	9.56e-6	PROSPERO
low complexity region	983	1004	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	C	1: 71,258,098	L2411R	probably damaging	Het
Als2	A	G	1: 59,206,587	W577R	probably damaging	Het
Aox2	C	A	1: 58,307,359	R551S	probably benign	Het
Areg	A	T	5: 91,146,718	H245L	possibly damaging	Het
Arhgap35	T	C	7: 16,563,467	T558A	possibly damaging	Het
Arhgef28	A	T	13: 97,936,860	C1322*	probably null	Het
Arhgef38	T	C	3: 133,206,958	R107G	possibly damaging	Het
Atf7ip	T	A	6: 136,571,502	F695L	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Bche	T	G	3: 73,648,678	Q549P	possibly damaging	Het
Blnk	A	G	19: 40,929,289	F417L	possibly damaging	Het
Bloc1s1	T	G	10: 128,923,386	K17T	probably damaging	Het
C330018D20Rik	G	T	18: 56,957,896	T65K	probably damaging	Het
Cers1	T	A	8: 70,321,578	S162T	possibly damaging	Het
Cgn	T	C	3: 94,779,522	K157E	probably benign	Het
Cldn7	G	A	11: 69,967,668	R196Q	probably benign	Het
Clrn2	C	A	5: 45,454,027	Q73K	probably benign	Het
Cmss1	A	G	16: 57,302,245	V262A	probably benign	Het
Cpb2	T	A	14: 75,260,688	V97E	probably damaging	Het
Ctnnd2	G	A	15: 30,683,241	V463I	probably benign	Het
Cyp7a1	A	T	4: 6,268,476	S416R	probably benign	Het
Dip2b	C	T	15: 100,190,079	R965C	probably damaging	Het
Dkk3	T	C	7: 112,150,658	T102A	probably benign	Het
Dmap1	C	A	4: 117,680,842		probably null	Het
Dnah12	C	A	14: 26,886,871	D3872E	possibly damaging	Het
Dnah7b	A	G	1: 46,119,398		probably null	Het
Dnaic1	C	T	4: 41,632,391	T575I	probably benign	Het
Dusp11	T	A	6: 85,959,233	K18*	probably null	Het
E2f2	A	T	4: 136,172,934	T52S	probably benign	Het
Elavl4	A	G	4: 110,290,644	L13S	probably benign	Het
Epor	T	C	9: 21,962,276	D59G	possibly damaging	Het
Eral1	A	G	11: 78,080,233	C43R	possibly damaging	Het
Fam135b	A	G	15: 71,490,848	V228A	probably benign	Het
Gba	T	C	3: 89,205,822	S187P	probably damaging	Het
Gcc2	G	T	10: 58,255,847		probably benign	Het
Gdap2	C	A	3: 100,202,256		probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gm8251	A	T	1: 44,057,257	N1560K	probably benign	Het
Gpr160	T	C	3: 30,896,463	L228P	probably benign	Het
Gsdmc2	A	C	15: 63,830,866	V184G	probably benign	Het
Gtf2e2	A	T	8: 33,776,052	K252M	probably damaging	Het
Gtf2e2	G	T	8: 33,776,053	K252N	probably benign	Het
Gys1	T	C	7: 45,438,105	Y102H	probably benign	Het
Hist1h4b	A	G	13: 23,757,226	D69G	probably damaging	Het
Ifit3b	A	C	19: 34,612,198	D258A	probably damaging	Het
Itpr3	T	A	17: 27,104,601	M1200K	probably damaging	Het
Kcng4	A	T	8: 119,626,359	F271I	probably damaging	Het
Klhdc2	C	T	12: 69,303,613	S144L	possibly damaging	Het
Lhcgr	A	G	17: 88,755,578	F222S	probably damaging	Het
Lrp5	C	G	19: 3,628,299	G519R	probably damaging	Het
Magel2	T	C	7: 62,378,767	V473A	probably benign	Het
Map1a	T	C	2: 121,304,295	V1864A	possibly damaging	Het
Mast4	T	A	13: 102,758,734	Q760H	probably damaging	Het
Mertk	A	G	2: 128,771,374	N437D	probably benign	Het
Mettl18	G	A	1: 163,996,775	V222I	probably benign	Het
Mical2	C	T	7: 112,334,948	T782M	probably benign	Het
Mocos	T	A	18: 24,686,693	V664E	probably damaging	Het
Neb	G	T	2: 52,295,294	N975K	probably benign	Het
Nectin3	A	T	16: 46,464,145	S59T	probably benign	Het
Nelfb	A	T	2: 25,203,888	M11K	probably damaging	Het
Nrp1	A	G	8: 128,476,169	N545S	probably damaging	Het
Olfr123	T	A	17: 37,796,357	N304K	probably benign	Het
Olfr1333	T	C	4: 118,830,281	D53G	probably damaging	Het
Olfr1472	A	T	19: 13,453,960	S186T	possibly damaging	Het
Olfr492	T	A	7: 108,323,047	T210S	probably benign	Het
Olfr66	T	A	7: 103,881,700	D181V	probably damaging	Het
Olfr814	A	T	10: 129,874,521	F79I	probably damaging	Het
Olfr968	T	C	9: 39,772,540	T87A	probably benign	Het
P3h1	A	G	4: 119,246,665	H587R	probably damaging	Het
Paqr4	A	G	17: 23,739,858		probably null	Het
Pde12	A	G	14: 26,669,098	V152A	probably benign	Het
Ppip5k1	C	A	2: 121,350,491	E45*	probably null	Het
Ptch2	C	T	4: 117,110,057	A677V	probably benign	Het
Rgs12	A	G	5: 35,020,345	N93S	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnf32	T	C	5: 29,203,147	S125P	probably damaging	Het
Robo4	A	G	9: 37,411,400	I850V	probably damaging	Het
Scap	T	A	9: 110,381,151	I876N	probably damaging	Het
Sin3a	A	G	9: 57,127,200	D1219G	possibly damaging	Het
Skint5	T	C	4: 113,885,808	E354G	unknown	Het
Spg20	A	G	3: 55,126,541	D396G	probably benign	Het
Spindoc	G	A	19: 7,373,659	S311L	probably benign	Het
Spta1	G	T	1: 174,223,328	R1791L	probably damaging	Het
Tbck	T	C	3: 132,801,517	I750T	possibly damaging	Het
Tcrg-V1	A	T	13: 19,340,304	Y66F	probably benign	Het
Tmem191c	T	C	16: 17,276,470		probably null	Het
Vmn2r125	A	G	4: 156,349,997	Y26C	probably damaging	Het
Zbtb17	T	C	4: 141,464,817	C358R	possibly damaging	Het
Zfp180	G	A	7: 24,105,434	G426E	probably damaging	Het
Zfp445	A	G	9: 122,853,886	V330A	probably benign	Het
Zfp595	A	G	13: 67,317,624	C192R	probably damaging	Het
Zkscan4	A	G	13: 21,484,453	H387R	probably damaging	Het

Other mutations in Dsg1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01064:Dsg1a	APN	18	20340206	missense	probably damaging	1.00
IGL01148:Dsg1a	APN	18	20320925	missense	probably damaging	0.97
IGL01534:Dsg1a	APN	18	20340996	missense	probably benign	0.06
IGL01566:Dsg1a	APN	18	20336783	splice site	probably benign
IGL01582:Dsg1a	APN	18	20328848	missense	probably null	1.00
IGL01913:Dsg1a	APN	18	20322236	missense	probably damaging	1.00
IGL01926:Dsg1a	APN	18	20333584	missense	possibly damaging	0.60
IGL02102:Dsg1a	APN	18	20332032	missense	probably benign	0.01
IGL02900:Dsg1a	APN	18	20328656	splice site	probably benign
IGL02937:Dsg1a	APN	18	20331534	missense	possibly damaging	0.93
IGL02962:Dsg1a	APN	18	20340324	missense	possibly damaging	0.92
IGL03003:Dsg1a	APN	18	20336819	missense	probably benign	0.43
PIT4687001:Dsg1a	UTSW	18	20331698	missense	probably benign	0.16
R0126:Dsg1a	UTSW	18	20340878	missense	probably benign	0.00
R0200:Dsg1a	UTSW	18	20340938	missense	probably benign	0.00
R0284:Dsg1a	UTSW	18	20331627	missense	probably damaging	0.98
R0394:Dsg1a	UTSW	18	20333750	missense	probably damaging	1.00
R0543:Dsg1a	UTSW	18	20340863	missense	probably damaging	1.00
R0656:Dsg1a	UTSW	18	20335892	splice site	probably benign
R0733:Dsg1a	UTSW	18	20338668	missense	probably damaging	0.97
R0750:Dsg1a	UTSW	18	20340153	missense	probably benign	0.10
R1300:Dsg1a	UTSW	18	20332149	missense	probably benign	0.19
R1501:Dsg1a	UTSW	18	20332019	missense	probably damaging	1.00
R1523:Dsg1a	UTSW	18	20322317	missense	probably damaging	0.99
R1673:Dsg1a	UTSW	18	20331504	missense	probably damaging	1.00
R1980:Dsg1a	UTSW	18	20338650	missense	probably damaging	1.00
R2102:Dsg1a	UTSW	18	20333773	missense	probably damaging	1.00
R2132:Dsg1a	UTSW	18	20340797	missense	probably damaging	1.00
R2299:Dsg1a	UTSW	18	20340150	missense	probably damaging	1.00
R2426:Dsg1a	UTSW	18	20336804	missense	probably damaging	0.96
R3031:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R4044:Dsg1a	UTSW	18	20324030	missense	probably damaging	1.00
R4075:Dsg1a	UTSW	18	20340070	missense	possibly damaging	0.53
R4644:Dsg1a	UTSW	18	20340728	missense	probably benign	0.04
R4661:Dsg1a	UTSW	18	20340533	missense	probably damaging	0.99
R4816:Dsg1a	UTSW	18	20333722	missense	probably benign	0.10
R5221:Dsg1a	UTSW	18	20324014	missense	possibly damaging	0.64
R5257:Dsg1a	UTSW	18	20320931	missense	probably damaging	1.00
R5360:Dsg1a	UTSW	18	20340954	missense	probably damaging	0.96
R5547:Dsg1a	UTSW	18	20336040	critical splice donor site	probably null
R5702:Dsg1a	UTSW	18	20336865	critical splice donor site	probably null
R6108:Dsg1a	UTSW	18	20340247	missense	probably benign	0.19
R6170:Dsg1a	UTSW	18	20335986	missense	probably damaging	0.99
R7018:Dsg1a	UTSW	18	20328738	missense	possibly damaging	0.48
R7201:Dsg1a	UTSW	18	20328311	missense	probably damaging	0.98
R7730:Dsg1a	UTSW	18	20331711	missense	possibly damaging	0.77
R7814:Dsg1a	UTSW	18	20338515	splice site	probably null
R8185:Dsg1a	UTSW	18	20340612	missense	probably damaging	1.00
R8297:Dsg1a	UTSW	18	20332033	missense	probably benign	0.02
R8377:Dsg1a	UTSW	18	20333774	missense	probably damaging	1.00
R8409:Dsg1a	UTSW	18	20340151	missense	probably damaging	1.00
R8775:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8775-TAIL:Dsg1a	UTSW	18	20340507	missense	probably damaging	0.98
R8818:Dsg1a	UTSW	18	20340542	missense	possibly damaging	0.87
R8821:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R8831:Dsg1a	UTSW	18	20320308	missense	probably damaging	0.96
R9030:Dsg1a	UTSW	18	20340492	missense	probably damaging	1.00
R9205:Dsg1a	UTSW	18	20340171	missense	probably damaging	1.00
R9239:Dsg1a	UTSW	18	20340693	missense	probably damaging	1.00
R9410:Dsg1a	UTSW	18	20331533	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CTGGACTGGGTAAGCAAGTG -3'
(R):5'- AACATTTGTGGAAGCTCGACCTG -3'

Sequencing Primer
(F):5'- GCAAGTGGATTTGTGTTCAACCAC -3'
(R):5'- GTGTCCAGGTCTGTAGCTACAAAC -3'

Posted On

2017-06-26