Mutagenetix > Incidental Mutations

Incidental Mutation 'R0515:Mroh7'

48178

Institutional Source

Beutler Lab

Gene Symbol

Mroh7

Ensembl Gene

ENSMUSG00000047502

Gene Name

maestro heat-like repeat family member 7

Synonyms

Heatr8, LOC381538, Gm1027

MMRRC Submission

038709-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0515 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

106680417-106730925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106691664 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1001 (M1001L)

Ref Sequence

ENSEMBL: ENSMUSP00000102382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106770]

Predicted Effect

probably benign
Transcript: ENSMUST00000106770
AA Change: M1001L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: M1001L

Domain	Start	End	E-Value	Type
low complexity region	39	61	N/A	INTRINSIC
low complexity region	318	332	N/A	INTRINSIC
low complexity region	563	573	N/A	INTRINSIC
SCOP:d1b3ua_	634	1218	6e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142954

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145374

Meta Mutation Damage Score

0.0655

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

98% (40/41)

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	A	G	2: 130,740,488	V515A	probably damaging	Het
App	C	T	16: 85,103,344		probably benign	Het
Arhgap11a	G	A	2: 113,837,471	T395I	possibly damaging	Het
Arhgef38	T	G	3: 133,149,540	H262P	probably damaging	Het
Cd96	A	G	16: 46,063,905		probably benign	Het
Cfap57	A	G	4: 118,620,402	S2P	probably damaging	Het
Cltc	A	G	11: 86,709,039	S948P	probably benign	Het
Cyp3a41a	A	T	5: 145,718,000	H30Q	probably damaging	Het
Dcp2	C	T	18: 44,399,731	L105F	probably benign	Het
Dennd4c	T	C	4: 86,813,466	V887A	possibly damaging	Het
Fam46b	A	T	4: 133,486,139	H107L	possibly damaging	Het
Gm11360	T	A	13: 27,956,160	D2E	probably damaging	Het
Gpank1	G	T	17: 35,123,499	A149S	probably damaging	Het
Gtf2i	C	A	5: 134,242,919	S792I	probably damaging	Het
Hvcn1	A	G	5: 122,233,519	N41D	probably damaging	Het
Klk1b5	A	G	7: 44,218,533	Y43C	probably damaging	Het
Lmtk2	A	G	5: 144,174,991	D843G	possibly damaging	Het
Lrriq1	A	T	10: 103,068,968		probably null	Het
Mapk8ip1	A	T	2: 92,387,356	I198N	possibly damaging	Het
Mill1	T	C	7: 18,264,873	V336A	probably benign	Het
Nfe2	T	A	15: 103,249,427	T46S	probably null	Het
Olfr1500	T	C	19: 13,827,821	S192G	probably damaging	Het
Olfr889	T	C	9: 38,116,017	S74P	probably damaging	Het
Parp4	T	C	14: 56,613,667	V709A	probably damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Prex2	A	T	1: 11,199,874	Q1261L	probably damaging	Het
Prl8a8	T	A	13: 27,508,367	I214L	probably damaging	Het
Rictor	C	T	15: 6,769,301	T343M	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Siglecf	T	C	7: 43,355,631		probably null	Het
Slco1b2	T	C	6: 141,669,410	F347S	possibly damaging	Het
Sox13	A	T	1: 133,383,719	Y592N	probably damaging	Het
Synj1	C	T	16: 90,994,022	A84T	possibly damaging	Het
Trpv5	T	A	6: 41,674,211		probably benign	Het
Tshz1	A	G	18: 84,015,965	V106A	probably benign	Het

Other mutations in Mroh7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01722:Mroh7	APN	4	106703161	missense	probably benign	0.00
IGL01729:Mroh7	APN	4	106704205	missense	possibly damaging	0.66
IGL01834:Mroh7	APN	4	106680874	missense	probably benign	0.00
IGL02003:Mroh7	APN	4	106702529	missense	probably damaging	0.96
IGL02135:Mroh7	APN	4	106702510	missense	probably damaging	1.00
IGL02335:Mroh7	APN	4	106707782	missense	probably damaging	1.00
IGL02532:Mroh7	APN	4	106720591	missense	probably benign	0.04
IGL02896:Mroh7	APN	4	106699816	missense	possibly damaging	0.94
IGL03066:Mroh7	APN	4	106692398	missense	possibly damaging	0.85
IGL03298:Mroh7	APN	4	106714091	nonsense	probably null
holy	UTSW	4	106709955	splice site	probably null
moley	UTSW	4	106694312	splice site	probably null
P0016:Mroh7	UTSW	4	106707857	critical splice acceptor site	probably null
R0019:Mroh7	UTSW	4	106721426	missense	probably benign	0.07
R0094:Mroh7	UTSW	4	106703184	missense	probably damaging	0.98
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0828:Mroh7	UTSW	4	106699876	missense	probably damaging	0.99
R0831:Mroh7	UTSW	4	106680793	missense	possibly damaging	0.92
R1107:Mroh7	UTSW	4	106707594	unclassified	probably null
R1301:Mroh7	UTSW	4	106720495	missense	probably damaging	0.99
R1456:Mroh7	UTSW	4	106695141	splice site	probably benign
R1491:Mroh7	UTSW	4	106703058	missense	probably benign	0.11
R1540:Mroh7	UTSW	4	106703076	missense	probably benign	0.11
R1560:Mroh7	UTSW	4	106711254	missense	possibly damaging	0.78
R1645:Mroh7	UTSW	4	106720668	missense	probably benign	0.19
R1804:Mroh7	UTSW	4	106694392	missense	possibly damaging	0.76
R2162:Mroh7	UTSW	4	106700181	missense	probably damaging	0.96
R2265:Mroh7	UTSW	4	106720927	missense	probably benign	0.01
R2866:Mroh7	UTSW	4	106691090	missense	probably damaging	1.00
R3716:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R3718:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R4530:Mroh7	UTSW	4	106720437	missense	possibly damaging	0.71
R4661:Mroh7	UTSW	4	106691513	critical splice donor site	probably null
R4706:Mroh7	UTSW	4	106691624	missense	possibly damaging	0.86
R4910:Mroh7	UTSW	4	106709955	splice site	probably null
R4965:Mroh7	UTSW	4	106690987	missense	possibly damaging	0.77
R4969:Mroh7	UTSW	4	106680873	missense	probably benign
R4971:Mroh7	UTSW	4	106691552	missense	probably benign	0.04
R5083:Mroh7	UTSW	4	106690318	missense	probably benign	0.03
R5207:Mroh7	UTSW	4	106721386	missense	probably damaging	0.97
R5364:Mroh7	UTSW	4	106691643	missense	probably benign	0.10
R5392:Mroh7	UTSW	4	106711251	critical splice donor site	probably null
R5630:Mroh7	UTSW	4	106720567	missense	possibly damaging	0.71
R5691:Mroh7	UTSW	4	106702618	missense	probably damaging	0.96
R5703:Mroh7	UTSW	4	106708560	missense	possibly damaging	0.77
R5707:Mroh7	UTSW	4	106681885	missense	possibly damaging	0.73
R5919:Mroh7	UTSW	4	106694312	splice site	probably null
R5979:Mroh7	UTSW	4	106720926	missense	probably benign	0.00
R6479:Mroh7	UTSW	4	106703188	missense	possibly damaging	0.75
R6520:Mroh7	UTSW	4	106721263	missense	probably benign	0.00
R6657:Mroh7	UTSW	4	106702500	nonsense	probably null
R6732:Mroh7	UTSW	4	106680713	frame shift	probably null
R6817:Mroh7	UTSW	4	106714115	missense	probably benign	0.00
R6980:Mroh7	UTSW	4	106700237	missense	probably benign	0.05
R7062:Mroh7	UTSW	4	106683980	missense	probably damaging	1.00
R7116:Mroh7	UTSW	4	106711320	missense	probably benign	0.07
R7134:Mroh7	UTSW	4	106720594	missense	probably damaging	0.99
R7169:Mroh7	UTSW	4	106691639	missense	probably damaging	0.99
R7419:Mroh7	UTSW	4	106683918	missense	probably benign
R7516:Mroh7	UTSW	4	106691119	missense	probably benign	0.00
R7525:Mroh7	UTSW	4	106709702	missense	probably benign	0.22
R7540:Mroh7	UTSW	4	106720398	missense	possibly damaging	0.85
R7849:Mroh7	UTSW	4	106721090	missense	probably benign
R7932:Mroh7	UTSW	4	106721090	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCGATGCCTTACGTCAGTGAAGTG -3'
(R):5'- AGCTTAGCCTTGTAGAAGCTGCCC -3'

Sequencing Primer
(F):5'- TCAGTGAAGTGGGGCAGC -3'
(R):5'- GACTCAGATGGCTAACTTGTGAC -3'

Posted On

2013-06-12