Incidental Mutation 'R0515:Cfap57'
ID 48179
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms LOC384050, Wdr65, 1110020C03Rik, C130004B06Rik
MMRRC Submission 038709-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0515 (G1)
Quality Score 199
Status Validated
Chromosome 4
Chromosomal Location 118411748-118477974 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118477599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030501] [ENSMUST00000071972] [ENSMUST00000081921] [ENSMUST00000147373]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000030501
SMART Domains Protein: ENSMUSP00000030501
Gene: ENSMUSG00000028729

DomainStartEndE-ValueType
Pfam:Ebp2 18 298 2.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071972
AA Change: S2P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: S2P

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081921
AA Change: S2P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: S2P

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130219
Predicted Effect probably benign
Transcript: ENSMUST00000147373
SMART Domains Protein: ENSMUSP00000114372
Gene: ENSMUSG00000028729

DomainStartEndE-ValueType
Pfam:Ebp2 13 187 4.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149837
Meta Mutation Damage Score 0.2137 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
App C T 16: 84,900,232 (GRCm39) probably benign Het
Arhgap11a G A 2: 113,667,816 (GRCm39) T395I possibly damaging Het
Arhgef38 T G 3: 132,855,301 (GRCm39) H262P probably damaging Het
Cd96 A G 16: 45,884,268 (GRCm39) probably benign Het
Cltc A G 11: 86,599,865 (GRCm39) S948P probably benign Het
Cyp3a41a A T 5: 145,654,810 (GRCm39) H30Q probably damaging Het
Dcp2 C T 18: 44,532,798 (GRCm39) L105F probably benign Het
Dennd4c T C 4: 86,731,703 (GRCm39) V887A possibly damaging Het
Dnaaf9 A G 2: 130,582,408 (GRCm39) V515A probably damaging Het
Gm11360 T A 13: 28,140,143 (GRCm39) D2E probably damaging Het
Gpank1 G T 17: 35,342,475 (GRCm39) A149S probably damaging Het
Gtf2i C A 5: 134,271,773 (GRCm39) S792I probably damaging Het
Hvcn1 A G 5: 122,371,582 (GRCm39) N41D probably damaging Het
Klk1b5 A G 7: 43,867,957 (GRCm39) Y43C probably damaging Het
Lmtk2 A G 5: 144,111,809 (GRCm39) D843G possibly damaging Het
Lrriq1 A T 10: 102,904,829 (GRCm39) probably null Het
Mapk8ip1 A T 2: 92,217,701 (GRCm39) I198N possibly damaging Het
Mill1 T C 7: 17,998,798 (GRCm39) V336A probably benign Het
Mroh7 T A 4: 106,548,861 (GRCm39) M1001L probably benign Het
Nfe2 T A 15: 103,157,854 (GRCm39) T46S probably null Het
Or8b40 T C 9: 38,027,313 (GRCm39) S74P probably damaging Het
Or9q1 T C 19: 13,805,185 (GRCm39) S192G probably damaging Het
Parp4 T C 14: 56,851,124 (GRCm39) V709A probably damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Prex2 A T 1: 11,270,098 (GRCm39) Q1261L probably damaging Het
Prl8a8 T A 13: 27,692,350 (GRCm39) I214L probably damaging Het
Rictor C T 15: 6,798,782 (GRCm39) T343M probably damaging Het
Sema6a G A 18: 47,423,112 (GRCm39) probably null Het
Siglecf T C 7: 43,005,055 (GRCm39) probably null Het
Slco1b2 T C 6: 141,615,136 (GRCm39) F347S possibly damaging Het
Sox13 A T 1: 133,311,457 (GRCm39) Y592N probably damaging Het
Synj1 C T 16: 90,790,910 (GRCm39) A84T possibly damaging Het
Tent5b A T 4: 133,213,450 (GRCm39) H107L possibly damaging Het
Trpv5 T A 6: 41,651,145 (GRCm39) probably benign Het
Tshz1 A G 18: 84,034,090 (GRCm39) V106A probably benign Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118,438,198 (GRCm39) missense probably benign 0.01
IGL00508:Cfap57 APN 4 118,438,367 (GRCm39) splice site probably null
IGL00857:Cfap57 APN 4 118,470,120 (GRCm39) critical splice donor site probably null
IGL01147:Cfap57 APN 4 118,446,198 (GRCm39) missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118,467,792 (GRCm39) missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118,470,137 (GRCm39) missense probably benign 0.21
IGL01615:Cfap57 APN 4 118,457,993 (GRCm39) missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118,470,214 (GRCm39) missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118,436,569 (GRCm39) missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118,438,302 (GRCm39) missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118,438,302 (GRCm39) missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118,426,545 (GRCm39) critical splice donor site probably null
IGL02800:Cfap57 APN 4 118,471,947 (GRCm39) missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118,441,936 (GRCm39) missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118,456,216 (GRCm39) missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118,433,842 (GRCm39) missense probably benign 0.29
IGL03376:Cfap57 APN 4 118,441,917 (GRCm39) missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118,450,271 (GRCm39) missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118,441,902 (GRCm39) missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118,456,209 (GRCm39) missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118,426,628 (GRCm39) missense possibly damaging 0.89
R0690:Cfap57 UTSW 4 118,426,924 (GRCm39) splice site probably benign
R0730:Cfap57 UTSW 4 118,470,117 (GRCm39) splice site probably null
R0737:Cfap57 UTSW 4 118,438,299 (GRCm39) missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118,419,069 (GRCm39) missense probably benign 0.04
R0880:Cfap57 UTSW 4 118,439,035 (GRCm39) nonsense probably null
R1085:Cfap57 UTSW 4 118,452,976 (GRCm39) missense probably benign 0.20
R1119:Cfap57 UTSW 4 118,463,873 (GRCm39) nonsense probably null
R1217:Cfap57 UTSW 4 118,463,849 (GRCm39) missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118,463,731 (GRCm39) critical splice donor site probably null
R1487:Cfap57 UTSW 4 118,471,978 (GRCm39) missense probably benign 0.01
R1676:Cfap57 UTSW 4 118,453,137 (GRCm39) missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118,426,843 (GRCm39) missense probably null 0.20
R1709:Cfap57 UTSW 4 118,428,901 (GRCm39) missense probably benign 0.00
R1719:Cfap57 UTSW 4 118,463,828 (GRCm39) missense probably benign 0.04
R1782:Cfap57 UTSW 4 118,472,172 (GRCm39) missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118,428,921 (GRCm39) missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118,457,091 (GRCm39) missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118,457,124 (GRCm39) missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118,472,207 (GRCm39) missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118,450,329 (GRCm39) missense probably benign 0.03
R2177:Cfap57 UTSW 4 118,463,885 (GRCm39) missense probably benign 0.00
R2322:Cfap57 UTSW 4 118,467,922 (GRCm39) missense probably benign
R3905:Cfap57 UTSW 4 118,453,036 (GRCm39) missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118,450,340 (GRCm39) missense probably benign 0.01
R4079:Cfap57 UTSW 4 118,456,194 (GRCm39) missense probably benign 0.34
R4962:Cfap57 UTSW 4 118,470,262 (GRCm39) missense probably benign 0.21
R4970:Cfap57 UTSW 4 118,477,568 (GRCm39) missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118,450,251 (GRCm39) missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118,453,045 (GRCm39) missense probably benign 0.01
R5482:Cfap57 UTSW 4 118,426,838 (GRCm39) missense probably benign
R5522:Cfap57 UTSW 4 118,453,085 (GRCm39) missense probably benign 0.41
R5626:Cfap57 UTSW 4 118,471,980 (GRCm39) missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118,426,656 (GRCm39) missense probably benign
R5712:Cfap57 UTSW 4 118,471,992 (GRCm39) missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118,428,942 (GRCm39) missense probably benign 0.00
R6244:Cfap57 UTSW 4 118,436,607 (GRCm39) missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118,426,648 (GRCm39) nonsense probably null
R6271:Cfap57 UTSW 4 118,452,956 (GRCm39) missense probably benign 0.13
R6330:Cfap57 UTSW 4 118,426,593 (GRCm39) missense probably benign
R6439:Cfap57 UTSW 4 118,446,172 (GRCm39) critical splice donor site probably null
R6639:Cfap57 UTSW 4 118,411,909 (GRCm39) missense probably benign 0.13
R6722:Cfap57 UTSW 4 118,441,914 (GRCm39) missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118,470,323 (GRCm39) missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118,477,906 (GRCm39) unclassified probably benign
R7162:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7174:Cfap57 UTSW 4 118,446,264 (GRCm39) missense probably benign 0.35
R7210:Cfap57 UTSW 4 118,433,900 (GRCm39) nonsense probably null
R7242:Cfap57 UTSW 4 118,450,293 (GRCm39) missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118,411,997 (GRCm39) nonsense probably null
R7359:Cfap57 UTSW 4 118,456,162 (GRCm39) missense probably benign 0.01
R7373:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7394:Cfap57 UTSW 4 118,450,334 (GRCm39) missense probably benign 0.00
R7401:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7412:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7414:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7452:Cfap57 UTSW 4 118,452,981 (GRCm39) missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118,446,198 (GRCm39) missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7642:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7741:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7744:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7745:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7842:Cfap57 UTSW 4 118,411,952 (GRCm39) nonsense probably null
R7936:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7940:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R7942:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8074:Cfap57 UTSW 4 118,426,822 (GRCm39) missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118,450,271 (GRCm39) missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8447:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8491:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8524:Cfap57 UTSW 4 118,472,128 (GRCm39) missense probably benign
R8670:Cfap57 UTSW 4 118,472,122 (GRCm39) missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118,450,203 (GRCm39) missense probably benign 0.04
R8790:Cfap57 UTSW 4 118,439,111 (GRCm39) missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118,426,799 (GRCm39) missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118,412,048 (GRCm39) missense probably benign 0.02
R9212:Cfap57 UTSW 4 118,436,649 (GRCm39) missense possibly damaging 0.95
R9442:Cfap57 UTSW 4 118,463,731 (GRCm39) critical splice donor site probably null
R9525:Cfap57 UTSW 4 118,433,778 (GRCm39) missense probably damaging 1.00
X0022:Cfap57 UTSW 4 118,471,942 (GRCm39) missense probably benign
Z1088:Cfap57 UTSW 4 118,439,079 (GRCm39) missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118,456,153 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCGGTTTTGTGTAGCACATGCC -3'
(R):5'- GCTTCGGATCTTTAGGAAGAGCACC -3'

Sequencing Primer
(F):5'- TGTGTAGCACATGCCTTTAATG -3'
(R):5'- TAGTCTAGTAACCCAGAGCCGTG -3'
Posted On 2013-06-12