Incidental Mutation 'R5988:Mpdz'
ID481800
Institutional Source Beutler Lab
Gene Symbol Mpdz
Ensembl Gene ENSMUSG00000028402
Gene Namemultiple PDZ domain protein
SynonymsB930003D11Rik, MUPP1
MMRRC Submission 044168-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location81278500-81442815 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 81284575 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000107262] [ENSMUST00000131547] [ENSMUST00000134726] [ENSMUST00000220807]
Predicted Effect probably null
Transcript: ENSMUST00000102830
SMART Domains Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1111 1126 N/A INTRINSIC
PDZ 1148 1231 2.43e-22 SMART
low complexity region 1233 1251 N/A INTRINSIC
PDZ 1346 1421 3.41e-17 SMART
low complexity region 1434 1445 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
PDZ 1479 1552 2.69e-15 SMART
PDZ 1622 1697 3.2e-22 SMART
PDZ 1719 1792 3.62e-21 SMART
low complexity region 1798 1815 N/A INTRINSIC
PDZ 1856 1933 9.79e-18 SMART
PDZ 1980 2055 2.39e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102830
SMART Domains Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1111 1126 N/A INTRINSIC
PDZ 1148 1231 2.43e-22 SMART
low complexity region 1233 1251 N/A INTRINSIC
PDZ 1346 1421 3.41e-17 SMART
low complexity region 1434 1445 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
PDZ 1479 1552 2.69e-15 SMART
PDZ 1622 1697 3.2e-22 SMART
PDZ 1719 1792 3.62e-21 SMART
low complexity region 1798 1815 N/A INTRINSIC
PDZ 1856 1933 9.79e-18 SMART
PDZ 1980 2055 2.39e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107258
SMART Domains Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
PDZ 1 73 3.42e-8 SMART
low complexity region 104 119 N/A INTRINSIC
PDZ 141 224 2.43e-22 SMART
PDZ 306 381 3.41e-17 SMART
low complexity region 394 405 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
PDZ 439 512 2.69e-15 SMART
PDZ 582 657 3.2e-22 SMART
PDZ 679 752 3.62e-21 SMART
low complexity region 758 775 N/A INTRINSIC
PDZ 816 893 9.79e-18 SMART
PDZ 940 1015 2.39e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107258
SMART Domains Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
PDZ 1 73 3.42e-8 SMART
low complexity region 104 119 N/A INTRINSIC
PDZ 141 224 2.43e-22 SMART
PDZ 306 381 3.41e-17 SMART
low complexity region 394 405 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
PDZ 439 512 2.69e-15 SMART
PDZ 582 657 3.2e-22 SMART
PDZ 679 752 3.62e-21 SMART
low complexity region 758 775 N/A INTRINSIC
PDZ 816 893 9.79e-18 SMART
PDZ 940 1015 2.39e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107262
SMART Domains Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1112 1127 N/A INTRINSIC
PDZ 1149 1232 2.43e-22 SMART
low complexity region 1234 1252 N/A INTRINSIC
PDZ 1347 1422 3.41e-17 SMART
low complexity region 1435 1446 N/A INTRINSIC
low complexity region 1455 1469 N/A INTRINSIC
PDZ 1480 1553 2.69e-15 SMART
PDZ 1623 1698 3.2e-22 SMART
PDZ 1720 1793 3.62e-21 SMART
low complexity region 1799 1816 N/A INTRINSIC
PDZ 1857 1934 9.79e-18 SMART
PDZ 1981 2056 2.39e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107262
SMART Domains Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1112 1127 N/A INTRINSIC
PDZ 1149 1232 2.43e-22 SMART
low complexity region 1234 1252 N/A INTRINSIC
PDZ 1347 1422 3.41e-17 SMART
low complexity region 1435 1446 N/A INTRINSIC
low complexity region 1455 1469 N/A INTRINSIC
PDZ 1480 1553 2.69e-15 SMART
PDZ 1623 1698 3.2e-22 SMART
PDZ 1720 1793 3.62e-21 SMART
low complexity region 1799 1816 N/A INTRINSIC
PDZ 1857 1934 9.79e-18 SMART
PDZ 1981 2056 2.39e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131418
Predicted Effect probably benign
Transcript: ENSMUST00000131547
SMART Domains Protein: ENSMUSP00000116767
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
Blast:PDZ 1 33 8e-15 BLAST
PDB:2OPG|B 1 37 1e-19 PDB
PDZ 55 128 3.62e-21 SMART
low complexity region 134 151 N/A INTRINSIC
Blast:PDZ 167 209 1e-11 BLAST
PDB:2IWP|B 173 209 3e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000134726
SMART Domains Protein: ENSMUSP00000116830
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
PDZ 90 137 7.6e0 SMART
PDZ 159 232 3.62e-21 SMART
low complexity region 238 255 N/A INTRINSIC
PDZ 296 373 9.79e-18 SMART
PDZ 420 495 2.39e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156441
Predicted Effect probably null
Transcript: ENSMUST00000220807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Ahnak C A 19: 9,009,347 probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
Armc10 T A 5: 21,660,583 S195T probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Fat1 A G 8: 45,029,456 T3051A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Il21r T C 7: 125,632,288 F296S probably damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Myh6 G T 14: 54,965,394 R23S probably damaging Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr59 T C 11: 74,288,853 V69A probably benign Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Mpdz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mpdz APN 4 81310224 nonsense probably null
IGL00325:Mpdz APN 4 81317631 missense probably damaging 1.00
IGL00497:Mpdz APN 4 81335742 missense probably benign 0.30
IGL00502:Mpdz APN 4 81369723 missense probably damaging 1.00
IGL00539:Mpdz APN 4 81361351 missense possibly damaging 0.83
IGL00938:Mpdz APN 4 81292512 missense probably damaging 1.00
IGL00990:Mpdz APN 4 81303584 splice site probably benign
IGL01394:Mpdz APN 4 81292491 missense possibly damaging 0.92
IGL01537:Mpdz APN 4 81369658 missense probably damaging 0.98
IGL01558:Mpdz APN 4 81295530 nonsense probably null
IGL01561:Mpdz APN 4 81284614 missense probably damaging 1.00
IGL01649:Mpdz APN 4 81303633 missense probably damaging 0.98
IGL01743:Mpdz APN 4 81317682 missense probably damaging 1.00
IGL01941:Mpdz APN 4 81286387 missense possibly damaging 0.91
IGL01969:Mpdz APN 4 81358724 missense probably damaging 0.98
IGL02023:Mpdz APN 4 81329529 missense probably damaging 0.99
IGL02081:Mpdz APN 4 81335869 missense probably damaging 1.00
IGL02304:Mpdz APN 4 81310157 missense possibly damaging 0.78
IGL02304:Mpdz APN 4 81297559 splice site probably benign
IGL02410:Mpdz APN 4 81297493 missense probably benign 0.13
IGL02449:Mpdz APN 4 81329422 splice site probably null
IGL02671:Mpdz APN 4 81290273 missense probably damaging 1.00
IGL02708:Mpdz APN 4 81284571 splice site probably null
IGL02718:Mpdz APN 4 81385202 missense probably damaging 1.00
IGL03065:Mpdz APN 4 81292565 missense probably damaging 0.98
IGL03378:Mpdz APN 4 81419048 splice site probably benign
PIT4458001:Mpdz UTSW 4 81419026 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0119:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0402:Mpdz UTSW 4 81361440 missense possibly damaging 0.51
R0499:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0718:Mpdz UTSW 4 81292473 missense possibly damaging 0.79
R0844:Mpdz UTSW 4 81421194 start gained probably benign
R0883:Mpdz UTSW 4 81359991 splice site probably benign
R0885:Mpdz UTSW 4 81369592 missense probably benign 0.04
R1344:Mpdz UTSW 4 81308319 missense probably benign 0.01
R1432:Mpdz UTSW 4 81292551 missense probably damaging 1.00
R1488:Mpdz UTSW 4 81348708 nonsense probably null
R1589:Mpdz UTSW 4 81421176 missense probably benign 0.00
R1756:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R1940:Mpdz UTSW 4 81361443 missense probably benign 0.01
R2068:Mpdz UTSW 4 81335830 missense probably null 1.00
R2182:Mpdz UTSW 4 81348722 missense probably damaging 1.00
R2213:Mpdz UTSW 4 81310172 missense probably damaging 0.99
R2265:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2268:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2269:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R3082:Mpdz UTSW 4 81285458 splice site probably benign
R3746:Mpdz UTSW 4 81363147 missense probably damaging 1.00
R3902:Mpdz UTSW 4 81307116 missense probably damaging 1.00
R4095:Mpdz UTSW 4 81383823 missense possibly damaging 0.77
R4097:Mpdz UTSW 4 81335700 missense probably damaging 1.00
R4206:Mpdz UTSW 4 81381762 missense probably benign 0.13
R4675:Mpdz UTSW 4 81383812 missense probably damaging 0.98
R4884:Mpdz UTSW 4 81361476 missense probably damaging 0.97
R5044:Mpdz UTSW 4 81381697 missense probably benign 0.16
R5050:Mpdz UTSW 4 81295448 missense probably benign 0.00
R5243:Mpdz UTSW 4 81306879 missense probably damaging 1.00
R5332:Mpdz UTSW 4 81292580 missense probably damaging 1.00
R5435:Mpdz UTSW 4 81283487 intron probably benign
R5720:Mpdz UTSW 4 81287694 missense probably damaging 0.99
R5743:Mpdz UTSW 4 81421188 start codon destroyed probably null 0.30
R5764:Mpdz UTSW 4 81356446 missense probably benign 0.13
R5876:Mpdz UTSW 4 81285474 nonsense probably null
R5938:Mpdz UTSW 4 81284614 missense probably damaging 1.00
R6125:Mpdz UTSW 4 81297527 missense probably benign 0.00
R6178:Mpdz UTSW 4 81308365 missense probably damaging 1.00
R6235:Mpdz UTSW 4 81385281 missense probably damaging 1.00
R6293:Mpdz UTSW 4 81360056 missense probably damaging 1.00
R6387:Mpdz UTSW 4 81381709 missense possibly damaging 0.69
R6488:Mpdz UTSW 4 81287733 missense probably benign 0.11
R6536:Mpdz UTSW 4 81383417 missense probably damaging 1.00
R6673:Mpdz UTSW 4 81356430 missense probably benign 0.11
R6879:Mpdz UTSW 4 81348656 missense possibly damaging 0.81
R7180:Mpdz UTSW 4 81335751 missense probably damaging 0.98
R7199:Mpdz UTSW 4 81297333 missense probably damaging 0.98
R7209:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R7309:Mpdz UTSW 4 81381958 intron probably null
R7359:Mpdz UTSW 4 81356395 missense probably benign 0.01
R7561:Mpdz UTSW 4 81307151 missense probably damaging 0.99
R7565:Mpdz UTSW 4 81303654 missense probably benign 0.01
R7738:Mpdz UTSW 4 81335749 missense probably benign 0.01
RF013:Mpdz UTSW 4 81293592 missense possibly damaging 0.60
X0011:Mpdz UTSW 4 81292759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGCTCGGAACACACTTTG -3'
(R):5'- GTTTAGAATCCTGCTTTGACCC -3'

Sequencing Primer
(F):5'- TGTTCCAAAGTTGCAATGTCC -3'
(R):5'- GACCCAAGCATGTGTGTTCCATG -3'
Posted On2017-06-26