Incidental Mutation 'R5988:Armc10'
ID481804
Institutional Source Beutler Lab
Gene Symbol Armc10
Ensembl Gene ENSMUSG00000038525
Gene Namearmadillo repeat containing 10
Synonyms2810037C14Rik
MMRRC Submission 044168-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location21645813-21662694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21660583 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 195 (S195T)
Ref Sequence ENSEMBL: ENSMUSP00000120269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060899] [ENSMUST00000072896] [ENSMUST00000095495] [ENSMUST00000115217] [ENSMUST00000148873]
Predicted Effect probably benign
Transcript: ENSMUST00000060899
SMART Domains Protein: ENSMUSP00000054458
Gene: ENSMUSG00000044968

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.5e-14 PFAM
Pfam:Lactamase_B_2 142 344 2.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072896
AA Change: S209T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072669
Gene: ENSMUSG00000038525
AA Change: S209T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Arm_2 48 300 2e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095495
AA Change: S209T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093149
Gene: ENSMUSG00000038525
AA Change: S209T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Arm_2 48 234 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115217
SMART Domains Protein: ENSMUSP00000110872
Gene: ENSMUSG00000044968

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:Lactamase_B_3 126 343 1.3e-13 PFAM
Pfam:Lactamase_B_2 142 344 1.4e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148873
AA Change: S195T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120269
Gene: ENSMUSG00000038525
AA Change: S195T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Arm_2 38 286 4.7e-113 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Ahnak C A 19: 9,009,347 probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Fat1 A G 8: 45,029,456 T3051A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Il21r T C 7: 125,632,288 F296S probably damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Mpdz A G 4: 81,284,575 probably null Het
Myh6 G T 14: 54,965,394 R23S probably damaging Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr59 T C 11: 74,288,853 V69A probably benign Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Armc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Armc10 APN 5 21661581 missense probably damaging 1.00
IGL01647:Armc10 APN 5 21646093 utr 5 prime probably benign
IGL02296:Armc10 APN 5 21660633 missense probably benign 0.00
R0220:Armc10 UTSW 5 21661584 missense probably benign 0.05
R0308:Armc10 UTSW 5 21647297 intron probably benign
R1757:Armc10 UTSW 5 21653457 missense probably damaging 1.00
R4332:Armc10 UTSW 5 21661581 missense probably damaging 1.00
R4486:Armc10 UTSW 5 21653434 missense probably damaging 1.00
R4656:Armc10 UTSW 5 21661550 missense probably benign 0.11
R4741:Armc10 UTSW 5 21651836 missense probably damaging 1.00
R4906:Armc10 UTSW 5 21661524 missense probably damaging 1.00
R5273:Armc10 UTSW 5 21653428 missense possibly damaging 0.89
R7088:Armc10 UTSW 5 21653392 missense probably damaging 0.96
R7212:Armc10 UTSW 5 21660583 missense probably damaging 1.00
R8063:Armc10 UTSW 5 21648770 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTAATGACGGCCTCTCTGAC -3'
(R):5'- ATGGAAAGTCTGCTGGTGCC -3'

Sequencing Primer
(F):5'- TCTCTGACAGTGGTGCCGAG -3'
(R):5'- TCTGCTGGTGCCACAGAGAAG -3'
Posted On2017-06-26