Incidental Mutation 'R5988:Wdfy3'
ID 481807
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene Name WD repeat and FYVE domain containing 3
Synonyms 2610509D04Rik, Ggtb3, Bchs, D5Ertd66e, Bwf1, Alfy
MMRRC Submission 044168-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.943) question?
Stock # R5988 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 101980822-102217787 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102032004 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2273 (S2273P)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000212024]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053177
AA Change: S2273P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: S2273P

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174598
AA Change: S2273P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: S2273P

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212024
AA Change: S2259P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T A 14: 29,715,030 (GRCm39) M615K possibly damaging Het
Acvr1c A T 2: 58,205,886 (GRCm39) C25S probably damaging Het
Adk A T 14: 21,473,616 (GRCm39) E291V probably benign Het
Ahnak C A 19: 8,986,711 (GRCm39) probably benign Het
Alg11 A G 8: 22,552,044 (GRCm39) T63A probably benign Het
Alox12 A T 11: 70,142,413 (GRCm39) S272T probably benign Het
Armc10 T A 5: 21,865,581 (GRCm39) S195T probably damaging Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Baat G A 4: 49,502,871 (GRCm39) P84S probably damaging Het
BB014433 G A 8: 15,091,854 (GRCm39) T333I probably damaging Het
BC035947 G A 1: 78,475,843 (GRCm39) R230* probably null Het
Bcr G A 10: 75,011,167 (GRCm39) G26E probably benign Het
Ccdc88b T C 19: 6,833,348 (GRCm39) E233G probably damaging Het
Cep295 A G 9: 15,252,770 (GRCm39) F353L probably damaging Het
Chd8 T C 14: 52,455,395 (GRCm39) M1031V probably damaging Het
Col17a1 C G 19: 47,642,659 (GRCm39) G885R probably damaging Het
Cyp11a1 A C 9: 57,928,117 (GRCm39) I214L probably benign Het
Cyp3a44 A T 5: 145,731,728 (GRCm39) S139R probably damaging Het
Ddhd2 G A 8: 26,238,589 (GRCm39) R64C probably damaging Het
Dll3 A G 7: 27,993,537 (GRCm39) W561R probably damaging Het
Dnajc3 T C 14: 119,195,376 (GRCm39) V97A possibly damaging Het
Drosha C T 15: 12,834,582 (GRCm39) probably benign Het
E2f8 T C 7: 48,524,743 (GRCm39) D302G probably damaging Het
Ecd C G 14: 20,374,629 (GRCm39) D504H probably damaging Het
Eif1ad15 T A 12: 88,288,202 (GRCm39) N17I unknown Het
Eif4g2 C A 7: 110,676,437 (GRCm39) V331L probably benign Het
Fam124a T C 14: 62,824,986 (GRCm39) I160T possibly damaging Het
Fat1 A G 8: 45,482,493 (GRCm39) T3051A probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm572 A G 4: 148,752,964 (GRCm39) E281G possibly damaging Het
Gm9944 T C 4: 144,179,775 (GRCm39) probably benign Het
Gstm5 A C 3: 107,803,270 (GRCm39) M1L probably benign Het
Havcr1 A G 11: 46,646,964 (GRCm39) T133A probably damaging Het
Hey1 T G 3: 8,731,379 (GRCm39) S68R probably damaging Het
Hsf2bp C T 17: 32,230,149 (GRCm39) probably null Het
Id2 T C 12: 25,145,723 (GRCm39) N96S probably benign Het
Ifi206 A C 1: 173,308,906 (GRCm39) S363R possibly damaging Het
Il21r T C 7: 125,231,460 (GRCm39) F296S probably damaging Het
Irgm2 A G 11: 58,111,013 (GRCm39) T247A probably benign Het
Irx5 T A 8: 93,087,299 (GRCm39) Y410* probably null Het
Kmt2c A G 5: 25,516,118 (GRCm39) I2575T probably benign Het
Lmbrd2 T A 15: 9,182,493 (GRCm39) probably null Het
Lrig1 A C 6: 94,605,023 (GRCm39) S191A probably damaging Het
Lrrc37 T C 11: 103,506,722 (GRCm39) probably benign Het
Lypd6b T A 2: 49,836,178 (GRCm39) C120S probably damaging Het
Mpdz A G 4: 81,202,812 (GRCm39) probably null Het
Myh6 G T 14: 55,202,851 (GRCm39) R23S probably damaging Het
Nat8f6 C T 6: 85,786,040 (GRCm39) M36I probably benign Het
Nol8 T A 13: 49,826,090 (GRCm39) M970K possibly damaging Het
Nrxn2 T C 19: 6,542,901 (GRCm39) F1042L possibly damaging Het
Nup160 T C 2: 90,519,553 (GRCm39) W277R probably damaging Het
Ogfr A T 2: 180,236,026 (GRCm39) T204S probably damaging Het
Or10j5 T A 1: 172,784,723 (GRCm39) Y120* probably null Het
Or1ak2 A G 2: 36,827,236 (GRCm39) Y35C probably damaging Het
Or1p1 T C 11: 74,179,679 (GRCm39) V69A probably benign Het
Or2n1d T C 17: 38,646,911 (GRCm39) F288L probably damaging Het
Or52n2b A T 7: 104,566,125 (GRCm39) V126E probably damaging Het
Or8c20 T C 9: 38,261,045 (GRCm39) V222A probably benign Het
Pcdh15 A G 10: 74,215,189 (GRCm39) I648V probably benign Het
Pced1b T A 15: 97,282,228 (GRCm39) V89E probably damaging Het
Phax G T 18: 56,708,564 (GRCm39) A43S probably benign Het
Phf20 A G 2: 156,149,250 (GRCm39) E976G probably damaging Het
Plin4 T C 17: 56,416,567 (GRCm39) T8A probably benign Het
Plxna1 G A 6: 89,334,522 (GRCm39) Q36* probably null Het
Pold1 T C 7: 44,190,004 (GRCm39) Y394C probably damaging Het
Ppp1r26 T A 2: 28,342,566 (GRCm39) V732E probably benign Het
Pramel5 A T 4: 143,999,716 (GRCm39) C124S possibly damaging Het
Prorp T A 12: 55,424,002 (GRCm39) M441K probably damaging Het
Prr14l C A 5: 32,988,195 (GRCm39) L433F probably damaging Het
Ptpn14 A G 1: 189,582,584 (GRCm39) Y477C probably damaging Het
Rcl1 T A 19: 29,099,167 (GRCm39) I154N probably damaging Het
Rfpl4 T C 7: 5,118,501 (GRCm39) Y23C probably damaging Het
Rims1 T C 1: 22,635,544 (GRCm39) K146E probably damaging Het
Rims2 A T 15: 39,155,577 (GRCm39) K126M probably damaging Het
Rpusd4 T A 9: 35,183,816 (GRCm39) probably null Het
Scn7a C T 2: 66,556,558 (GRCm39) W342* probably null Het
Sh3pxd2a A G 19: 47,353,077 (GRCm39) V128A probably benign Het
Slc15a5 T C 6: 138,020,529 (GRCm39) H268R probably benign Het
Slc22a3 T C 17: 12,652,782 (GRCm39) I321V possibly damaging Het
Slc7a6os A G 8: 106,928,965 (GRCm39) S231P probably benign Het
Smad5 T C 13: 56,883,798 (GRCm39) S395P probably damaging Het
Sorbs3 G A 14: 70,440,752 (GRCm39) T20I probably benign Het
Spata9 A G 13: 76,116,236 (GRCm39) I42V probably benign Het
Srl C T 16: 4,340,892 (GRCm39) C9Y unknown Het
Sugp2 T C 8: 70,695,875 (GRCm39) F283L probably benign Het
Syne2 T C 12: 75,976,191 (GRCm39) probably null Het
Taar6 A G 10: 23,861,154 (GRCm39) Y131H probably damaging Het
Tango2 T C 16: 18,120,554 (GRCm39) T137A probably damaging Het
Tas2r106 T A 6: 131,655,606 (GRCm39) I82L probably benign Het
Tbc1d32 T C 10: 55,964,433 (GRCm39) E922G probably damaging Het
Tgfb2 G T 1: 186,436,778 (GRCm39) P65Q probably benign Het
Tjp2 T G 19: 24,091,464 (GRCm39) I566L probably benign Het
Tnrc6a T A 7: 122,781,603 (GRCm39) N1424K probably damaging Het
Trim7 A T 11: 48,728,513 (GRCm39) M54L probably benign Het
Trpm1 T A 7: 63,876,553 (GRCm39) S535R probably benign Het
Tsc2 T A 17: 24,839,740 (GRCm39) N417I probably damaging Het
Ttn T C 2: 76,800,132 (GRCm39) R359G probably benign Het
Vim A G 2: 13,587,296 (GRCm39) T458A probably benign Het
Vps11 A T 9: 44,265,221 (GRCm39) S612R probably benign Het
Wwox G T 8: 115,433,081 (GRCm39) R249L probably benign Het
Zbtb4 G T 11: 69,669,790 (GRCm39) G838C probably damaging Het
Zkscan3 A T 13: 21,580,461 (GRCm39) C76S probably damaging Het
Znrf3 C T 11: 5,231,776 (GRCm39) C483Y probably damaging Het
Zscan2 A G 7: 80,525,947 (GRCm39) K556R possibly damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 102,063,204 (GRCm39) critical splice donor site probably null
IGL00567:Wdfy3 APN 5 102,059,896 (GRCm39) splice site probably benign
IGL01288:Wdfy3 APN 5 102,049,857 (GRCm39) splice site probably null
IGL01323:Wdfy3 APN 5 102,042,930 (GRCm39) missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 102,091,986 (GRCm39) missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 102,047,897 (GRCm39) missense probably benign
IGL01560:Wdfy3 APN 5 102,105,352 (GRCm39) nonsense probably null
IGL01566:Wdfy3 APN 5 102,044,454 (GRCm39) splice site probably benign
IGL01616:Wdfy3 APN 5 102,061,126 (GRCm39) missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 102,055,354 (GRCm39) missense probably benign
IGL01791:Wdfy3 APN 5 102,085,278 (GRCm39) missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 102,071,947 (GRCm39) missense probably benign 0.11
IGL01953:Wdfy3 APN 5 102,042,894 (GRCm39) nonsense probably null
IGL02121:Wdfy3 APN 5 102,046,376 (GRCm39) missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 102,109,023 (GRCm39) missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 102,070,475 (GRCm39) missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 102,036,058 (GRCm39) missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 102,044,341 (GRCm39) missense probably benign 0.37
IGL02801:Wdfy3 APN 5 102,055,453 (GRCm39) missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 102,116,786 (GRCm39) missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 102,003,337 (GRCm39) missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 102,042,778 (GRCm39) missense probably null 1.00
IGL03064:Wdfy3 APN 5 102,083,863 (GRCm39) missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 102,014,142 (GRCm39) missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101,992,778 (GRCm39) splice site probably benign
IGL03237:Wdfy3 APN 5 101,992,465 (GRCm39) missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 102,048,016 (GRCm39) missense probably damaging 1.00
Esurient UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 102,077,847 (GRCm39) missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 102,030,827 (GRCm39) frame shift probably null
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101,996,215 (GRCm39) missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101,992,912 (GRCm39) missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 102,037,161 (GRCm39) missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 102,091,899 (GRCm39) missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101,992,480 (GRCm39) missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 102,035,971 (GRCm39) missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0148:Wdfy3 UTSW 5 102,065,277 (GRCm39) missense probably benign 0.05
R0279:Wdfy3 UTSW 5 102,015,958 (GRCm39) missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 102,096,832 (GRCm39) missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 102,105,309 (GRCm39) missense probably benign 0.13
R0513:Wdfy3 UTSW 5 102,038,655 (GRCm39) missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 102,054,051 (GRCm39) missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101,984,038 (GRCm39) missense probably benign
R0787:Wdfy3 UTSW 5 102,105,254 (GRCm39) missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 102,017,917 (GRCm39) missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 102,030,832 (GRCm39) missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 102,023,797 (GRCm39) missense probably benign
R1350:Wdfy3 UTSW 5 102,046,418 (GRCm39) missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 102,032,080 (GRCm39) splice site probably benign
R1446:Wdfy3 UTSW 5 101,999,176 (GRCm39) missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 102,085,604 (GRCm39) missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 102,065,445 (GRCm39) missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101,991,947 (GRCm39) missense probably benign
R1633:Wdfy3 UTSW 5 102,129,414 (GRCm39) missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 102,023,781 (GRCm39) missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 102,089,313 (GRCm39) missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 102,074,391 (GRCm39) frame shift probably null
R1743:Wdfy3 UTSW 5 101,991,931 (GRCm39) missense probably benign 0.12
R1745:Wdfy3 UTSW 5 102,096,795 (GRCm39) missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 102,042,865 (GRCm39) missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 102,063,242 (GRCm39) missense probably benign 0.00
R1854:Wdfy3 UTSW 5 102,036,052 (GRCm39) missense probably benign 0.05
R1880:Wdfy3 UTSW 5 102,065,301 (GRCm39) missense probably benign 0.05
R1930:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 102,067,275 (GRCm39) missense probably benign 0.30
R1965:Wdfy3 UTSW 5 102,099,178 (GRCm39) missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 102,008,352 (GRCm39) missense probably null 1.00
R2087:Wdfy3 UTSW 5 102,042,926 (GRCm39) missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 102,046,291 (GRCm39) critical splice donor site probably null
R2192:Wdfy3 UTSW 5 102,055,408 (GRCm39) missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 102,037,150 (GRCm39) missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 102,036,189 (GRCm39) splice site probably benign
R2406:Wdfy3 UTSW 5 102,036,125 (GRCm39) missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 102,023,796 (GRCm39) missense probably benign 0.04
R2937:Wdfy3 UTSW 5 102,091,988 (GRCm39) missense probably benign 0.07
R3765:Wdfy3 UTSW 5 102,009,266 (GRCm39) missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 102,085,466 (GRCm39) missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 102,092,105 (GRCm39) nonsense probably null
R3947:Wdfy3 UTSW 5 102,017,902 (GRCm39) missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 102,071,961 (GRCm39) splice site probably benign
R4065:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4066:Wdfy3 UTSW 5 102,070,313 (GRCm39) missense probably benign 0.08
R4110:Wdfy3 UTSW 5 102,047,924 (GRCm39) critical splice donor site probably null
R4235:Wdfy3 UTSW 5 102,070,500 (GRCm39) critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 102,058,850 (GRCm39) missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 102,054,011 (GRCm39) missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 102,031,949 (GRCm39) missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 102,091,800 (GRCm39) missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 102,077,894 (GRCm39) missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 102,091,809 (GRCm39) missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 102,042,787 (GRCm39) missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 102,096,838 (GRCm39) nonsense probably null
R4973:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4976:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4984:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R4986:Wdfy3 UTSW 5 102,090,985 (GRCm39) missense probably benign 0.00
R5068:Wdfy3 UTSW 5 102,042,803 (GRCm39) missense probably benign 0.15
R5105:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 102,015,972 (GRCm39) missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 102,091,969 (GRCm39) missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101,997,133 (GRCm39) critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101,994,972 (GRCm39) missense probably null 0.03
R5303:Wdfy3 UTSW 5 102,100,849 (GRCm39) missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 102,020,724 (GRCm39) missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 102,067,312 (GRCm39) missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 102,044,425 (GRCm39) missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101,984,140 (GRCm39) missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 102,009,314 (GRCm39) missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 102,017,855 (GRCm39) missense probably damaging 1.00
R6017:Wdfy3 UTSW 5 101,999,225 (GRCm39) missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101,997,289 (GRCm39) missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 102,046,295 (GRCm39) missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 102,020,831 (GRCm39) missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 102,116,812 (GRCm39) missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 102,061,045 (GRCm39) missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 102,101,032 (GRCm39) missense probably benign 0.19
R6776:Wdfy3 UTSW 5 102,031,911 (GRCm39) missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 102,065,297 (GRCm39) nonsense probably null
R6809:Wdfy3 UTSW 5 102,071,813 (GRCm39) missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 102,100,865 (GRCm39) missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101,991,932 (GRCm39) missense probably benign 0.10
R7014:Wdfy3 UTSW 5 102,042,775 (GRCm39) critical splice donor site probably null
R7034:Wdfy3 UTSW 5 102,055,384 (GRCm39) missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 102,003,415 (GRCm39) missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 102,063,303 (GRCm39) missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 102,091,758 (GRCm39) missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 102,049,785 (GRCm39) missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101,984,074 (GRCm39) missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 102,003,389 (GRCm39) missense probably benign 0.02
R7418:Wdfy3 UTSW 5 102,105,366 (GRCm39) missense probably benign 0.08
R7533:Wdfy3 UTSW 5 102,030,354 (GRCm39) missense probably benign 0.27
R7543:Wdfy3 UTSW 5 102,083,925 (GRCm39) missense probably benign 0.00
R7625:Wdfy3 UTSW 5 102,003,252 (GRCm39) splice site probably null
R7788:Wdfy3 UTSW 5 101,996,223 (GRCm39) missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 102,099,265 (GRCm39) nonsense probably null
R7810:Wdfy3 UTSW 5 102,042,940 (GRCm39) missense probably benign 0.01
R8204:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.00
R8268:Wdfy3 UTSW 5 102,089,476 (GRCm39) missense probably damaging 1.00
R8286:Wdfy3 UTSW 5 102,085,287 (GRCm39) missense probably benign
R8507:Wdfy3 UTSW 5 102,020,767 (GRCm39) missense probably benign 0.05
R8514:Wdfy3 UTSW 5 101,999,219 (GRCm39) missense possibly damaging 0.92
R8536:Wdfy3 UTSW 5 102,033,064 (GRCm39) missense probably benign
R8710:Wdfy3 UTSW 5 102,030,349 (GRCm39) missense probably damaging 1.00
R8735:Wdfy3 UTSW 5 102,077,951 (GRCm39) missense probably benign 0.00
R8749:Wdfy3 UTSW 5 102,030,446 (GRCm39) missense probably damaging 1.00
R8931:Wdfy3 UTSW 5 102,065,421 (GRCm39) missense probably benign 0.11
R8943:Wdfy3 UTSW 5 101,993,231 (GRCm39) intron probably benign
R8968:Wdfy3 UTSW 5 102,011,983 (GRCm39) missense probably benign 0.05
R8979:Wdfy3 UTSW 5 102,096,764 (GRCm39) missense probably damaging 1.00
R8998:Wdfy3 UTSW 5 101,993,058 (GRCm39) missense probably benign 0.05
R9045:Wdfy3 UTSW 5 101,995,040 (GRCm39) missense probably damaging 1.00
R9068:Wdfy3 UTSW 5 102,000,451 (GRCm39) missense probably benign 0.34
R9105:Wdfy3 UTSW 5 102,030,512 (GRCm39) missense probably benign 0.05
R9122:Wdfy3 UTSW 5 102,091,831 (GRCm39) missense probably damaging 1.00
R9209:Wdfy3 UTSW 5 102,078,830 (GRCm39) missense probably benign 0.01
R9249:Wdfy3 UTSW 5 101,996,359 (GRCm39) missense possibly damaging 0.82
R9348:Wdfy3 UTSW 5 102,089,358 (GRCm39) missense probably damaging 1.00
R9481:Wdfy3 UTSW 5 102,000,478 (GRCm39) missense probably benign 0.19
R9490:Wdfy3 UTSW 5 102,078,716 (GRCm39) missense probably benign 0.29
R9524:Wdfy3 UTSW 5 102,055,333 (GRCm39) missense probably benign 0.03
R9545:Wdfy3 UTSW 5 102,100,957 (GRCm39) missense
R9548:Wdfy3 UTSW 5 102,033,059 (GRCm39) missense probably damaging 0.99
R9636:Wdfy3 UTSW 5 102,047,899 (GRCm39) missense probably benign
R9750:Wdfy3 UTSW 5 102,077,960 (GRCm39) missense probably benign 0.00
R9766:Wdfy3 UTSW 5 102,042,866 (GRCm39) missense possibly damaging 0.90
R9771:Wdfy3 UTSW 5 102,000,195 (GRCm39) missense probably damaging 1.00
Z1177:Wdfy3 UTSW 5 102,048,107 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CTTGCCTAGGTTAGCAGGATG -3'
(R):5'- TTTCCGACTGTGCTTGACCG -3'

Sequencing Primer
(F):5'- TGCCTAGGTTAGCAGGATGATATAAC -3'
(R):5'- ACTGTGCTTGACCGCTGAGAG -3'
Posted On 2017-06-26