Incidental Mutation 'R0515:Hvcn1'
ID48181
Institutional Source Beutler Lab
Gene Symbol Hvcn1
Ensembl Gene ENSMUSG00000064267
Gene Namehydrogen voltage-gated channel 1
SynonymsBTS, 0610039P13Rik, mVSOP
MMRRC Submission 038709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0515 (G1)
Quality Score176
Status Validated
Chromosome5
Chromosomal Location122206804-122242297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122233519 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 41 (N41D)
Ref Sequence ENSEMBL: ENSMUSP00000118151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072602] [ENSMUST00000100747] [ENSMUST00000111738] [ENSMUST00000143560] [ENSMUST00000145854] [ENSMUST00000196187]
Predicted Effect probably damaging
Transcript: ENSMUST00000072602
AA Change: N41D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072401
Gene: ENSMUSG00000064267
AA Change: N41D

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Pfam:Ion_trans 94 226 1.2e-9 PFAM
Pfam:VGPC1_C 222 269 1.5e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100747
AA Change: N41D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098312
Gene: ENSMUSG00000064267
AA Change: N41D

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
low complexity region 104 120 N/A INTRINSIC
Pfam:Ion_trans 137 226 2.9e-7 PFAM
low complexity region 255 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111738
SMART Domains Protein: ENSMUSP00000107367
Gene: ENSMUSG00000038593

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 36 N/A INTRINSIC
Pfam:DUF1619 82 395 8.4e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143560
AA Change: N41D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118013
Gene: ENSMUSG00000064267
AA Change: N41D

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
PDB:3WKV|A 73 157 9e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000145854
AA Change: N41D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000196187
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated protein channel protein expressed more highly in certain cells of the immune system. Phagocytic cells produce superoxide anions which require this channel protein, and in B cells this same process facilitates antibody production. This same channel protein, however, can also regulate functions in other cells including spermatozoa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele lack neutrophil and macrophage voltage-gated proton pumps. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,740,488 V515A probably damaging Het
App C T 16: 85,103,344 probably benign Het
Arhgap11a G A 2: 113,837,471 T395I possibly damaging Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Cd96 A G 16: 46,063,905 probably benign Het
Cfap57 A G 4: 118,620,402 S2P probably damaging Het
Cltc A G 11: 86,709,039 S948P probably benign Het
Cyp3a41a A T 5: 145,718,000 H30Q probably damaging Het
Dcp2 C T 18: 44,399,731 L105F probably benign Het
Dennd4c T C 4: 86,813,466 V887A possibly damaging Het
Fam46b A T 4: 133,486,139 H107L possibly damaging Het
Gm11360 T A 13: 27,956,160 D2E probably damaging Het
Gpank1 G T 17: 35,123,499 A149S probably damaging Het
Gtf2i C A 5: 134,242,919 S792I probably damaging Het
Klk1b5 A G 7: 44,218,533 Y43C probably damaging Het
Lmtk2 A G 5: 144,174,991 D843G possibly damaging Het
Lrriq1 A T 10: 103,068,968 probably null Het
Mapk8ip1 A T 2: 92,387,356 I198N possibly damaging Het
Mill1 T C 7: 18,264,873 V336A probably benign Het
Mroh7 T A 4: 106,691,664 M1001L probably benign Het
Nfe2 T A 15: 103,249,427 T46S probably null Het
Olfr1500 T C 19: 13,827,821 S192G probably damaging Het
Olfr889 T C 9: 38,116,017 S74P probably damaging Het
Parp4 T C 14: 56,613,667 V709A probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Prex2 A T 1: 11,199,874 Q1261L probably damaging Het
Prl8a8 T A 13: 27,508,367 I214L probably damaging Het
Rictor C T 15: 6,769,301 T343M probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Siglecf T C 7: 43,355,631 probably null Het
Slco1b2 T C 6: 141,669,410 F347S possibly damaging Het
Sox13 A T 1: 133,383,719 Y592N probably damaging Het
Synj1 C T 16: 90,994,022 A84T possibly damaging Het
Trpv5 T A 6: 41,674,211 probably benign Het
Tshz1 A G 18: 84,015,965 V106A probably benign Het
Other mutations in Hvcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Hvcn1 APN 5 122238471 missense probably benign 0.00
IGL01383:Hvcn1 APN 5 122237703 missense probably damaging 0.99
R0523:Hvcn1 UTSW 5 122216365 critical splice donor site probably null
R5068:Hvcn1 UTSW 5 122233481 missense probably damaging 1.00
R5438:Hvcn1 UTSW 5 122238464 missense probably damaging 1.00
R7178:Hvcn1 UTSW 5 122233510 missense probably damaging 1.00
R7404:Hvcn1 UTSW 5 122237685 missense probably damaging 1.00
R7634:Hvcn1 UTSW 5 122233523 missense probably damaging 1.00
R7879:Hvcn1 UTSW 5 122238638 critical splice donor site probably null
R7962:Hvcn1 UTSW 5 122238638 critical splice donor site probably null
V5622:Hvcn1 UTSW 5 122233539 intron probably benign
V5622:Hvcn1 UTSW 5 122233539 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTGGCCTCTTGTACACCGAGATAC -3'
(R):5'- AAGGTTCTCAGAAAGCGCCTGC -3'

Sequencing Primer
(F):5'- TAGGCTGCTCTCTGAGCAC -3'
(R):5'- ACCTTAGAGACCTGGCGAC -3'
Posted On2013-06-12