Mutagenetix > Incidental Mutation

Incidental Mutation 'R5988:Trpm1'

481818

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

044168-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5988 (G1)

Quality Score

130.008

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 64226805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 535 (S535R)

Ref Sequence

ENSEMBL: ENSMUSP00000146140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: S651R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: S651R

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000177102

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205939

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: S535R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: S651R

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206740

Coding Region Coverage

1x: 99.8%
3x: 99.1%
10x: 95.3%
20x: 84.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,377,217	M441K	probably damaging	Het
Actr8	T	A	14: 29,993,073	M615K	possibly damaging	Het
Acvr1c	A	T	2: 58,315,874	C25S	probably damaging	Het
Adk	A	T	14: 21,423,548	E291V	probably benign	Het
Ahnak	C	A	19: 9,009,347		probably benign	Het
Alg11	A	G	8: 22,062,028	T63A	probably benign	Het
Alox12	A	T	11: 70,251,587	S272T	probably benign	Het
Armc10	T	A	5: 21,660,583	S195T	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Baat	G	A	4: 49,502,871	P84S	probably damaging	Het
BB014433	G	A	8: 15,041,854	T333I	probably damaging	Het
BC035947	G	A	1: 78,499,206	R230*	probably null	Het
Bcr	G	A	10: 75,175,335	G26E	probably benign	Het
Ccdc88b	T	C	19: 6,855,980	E233G	probably damaging	Het
Cep295	A	G	9: 15,341,474	F353L	probably damaging	Het
Chd8	T	C	14: 52,217,938	M1031V	probably damaging	Het
Col17a1	C	G	19: 47,654,220	G885R	probably damaging	Het
Cyp11a1	A	C	9: 58,020,834	I214L	probably benign	Het
Cyp3a44	A	T	5: 145,794,918	S139R	probably damaging	Het
Ddhd2	G	A	8: 25,748,562	R64C	probably damaging	Het
Dll3	A	G	7: 28,294,112	W561R	probably damaging	Het
Dnajc3	T	C	14: 118,957,964	V97A	possibly damaging	Het
Drosha	C	T	15: 12,834,496		probably benign	Het
E2f8	T	C	7: 48,874,995	D302G	probably damaging	Het
Ecd	C	G	14: 20,324,561	D504H	probably damaging	Het
Eif4g2	C	A	7: 111,077,230	V331L	probably benign	Het
Fam124a	T	C	14: 62,587,537	I160T	possibly damaging	Het
Fat1	A	G	8: 45,029,456	T3051A	probably benign	Het
Gm10271	A	T	10: 116,972,592	F6L	probably damaging	Het
Gm5039	T	A	12: 88,321,432	N17I	unknown	Het
Gm572	A	G	4: 148,668,507	E281G	possibly damaging	Het
Gm884	T	C	11: 103,615,896		probably benign	Het
Gm9944	T	C	4: 144,453,205		probably benign	Het
Gstm5	A	C	3: 107,895,954	M1L	probably benign	Het
Havcr1	A	G	11: 46,756,137	T133A	probably damaging	Het
Hey1	T	G	3: 8,666,319	S68R	probably damaging	Het
Hsf2bp	C	T	17: 32,011,175		probably null	Het
Id2	T	C	12: 25,095,724	N96S	probably benign	Het
Ifi206	A	C	1: 173,481,340	S363R	possibly damaging	Het
Il21r	T	C	7: 125,632,288	F296S	probably damaging	Het
Irgm2	A	G	11: 58,220,187	T247A	probably benign	Het
Irx5	T	A	8: 92,360,671	Y410*	probably null	Het
Kmt2c	A	G	5: 25,311,120	I2575T	probably benign	Het
Lmbrd2	T	A	15: 9,182,406		probably null	Het
Lrig1	A	C	6: 94,628,042	S191A	probably damaging	Het
Lypd6b	T	A	2: 49,946,166	C120S	probably damaging	Het
Mpdz	A	G	4: 81,284,575		probably null	Het
Myh6	G	T	14: 54,965,394	R23S	probably damaging	Het
Nat8f6	C	T	6: 85,809,058	M36I	probably benign	Het
Nol8	T	A	13: 49,672,614	M970K	possibly damaging	Het
Nrxn2	T	C	19: 6,492,871	F1042L	possibly damaging	Het
Nup160	T	C	2: 90,689,209	W277R	probably damaging	Het
Ogfr	A	T	2: 180,594,233	T204S	probably damaging	Het
Olfr136	T	C	17: 38,336,020	F288L	probably damaging	Het
Olfr16	T	A	1: 172,957,156	Y120*	probably null	Het
Olfr356	A	G	2: 36,937,224	Y35C	probably damaging	Het
Olfr59	T	C	11: 74,288,853	V69A	probably benign	Het
Olfr667	A	T	7: 104,916,918	V126E	probably damaging	Het
Olfr898	T	C	9: 38,349,749	V222A	probably benign	Het
Pcdh15	A	G	10: 74,379,357	I648V	probably benign	Het
Pced1b	T	A	15: 97,384,347	V89E	probably damaging	Het
Phax	G	T	18: 56,575,492	A43S	probably benign	Het
Phf20	A	G	2: 156,307,330	E976G	probably damaging	Het
Plin4	T	C	17: 56,109,567	T8A	probably benign	Het
Plxna1	G	A	6: 89,357,540	Q36*	probably null	Het
Pold1	T	C	7: 44,540,580	Y394C	probably damaging	Het
Ppp1r26	T	A	2: 28,452,554	V732E	probably benign	Het
Pramel5	A	T	4: 144,273,146	C124S	possibly damaging	Het
Prr14l	C	A	5: 32,830,851	L433F	probably damaging	Het
Ptpn14	A	G	1: 189,850,387	Y477C	probably damaging	Het
Rcl1	T	A	19: 29,121,767	I154N	probably damaging	Het
Rfpl4	T	C	7: 5,115,502	Y23C	probably damaging	Het
Rims1	T	C	1: 22,596,463	K146E	probably damaging	Het
Rims2	A	T	15: 39,292,182	K126M	probably damaging	Het
Rpusd4	T	A	9: 35,272,520		probably null	Het
Scn7a	C	T	2: 66,726,214	W342*	probably null	Het
Sh3pxd2a	A	G	19: 47,364,638	V128A	probably benign	Het
Slc15a5	T	C	6: 138,043,531	H268R	probably benign	Het
Slc22a3	T	C	17: 12,433,895	I321V	possibly damaging	Het
Slc7a6os	A	G	8: 106,202,333	S231P	probably benign	Het
Smad5	T	C	13: 56,735,985	S395P	probably damaging	Het
Sorbs3	G	A	14: 70,203,303	T20I	probably benign	Het
Spata9	A	G	13: 75,968,117	I42V	probably benign	Het
Srl	C	T	16: 4,523,028	C9Y	unknown	Het
Sugp2	T	C	8: 70,243,225	F283L	probably benign	Het
Syne2	T	C	12: 75,929,417		probably null	Het
Taar6	A	G	10: 23,985,256	Y131H	probably damaging	Het
Tango2	T	C	16: 18,302,690	T137A	probably damaging	Het
Tas2r106	T	A	6: 131,678,643	I82L	probably benign	Het
Tbc1d32	T	C	10: 56,088,337	E922G	probably damaging	Het
Tgfb2	G	T	1: 186,704,581	P65Q	probably benign	Het
Tjp2	T	G	19: 24,114,100	I566L	probably benign	Het
Tnrc6a	T	A	7: 123,182,380	N1424K	probably damaging	Het
Trim7	A	T	11: 48,837,686	M54L	probably benign	Het
Tsc2	T	A	17: 24,620,766	N417I	probably damaging	Het
Ttn	T	C	2: 76,969,788	R359G	probably benign	Het
Vim	A	G	2: 13,582,485	T458A	probably benign	Het
Vps11	A	T	9: 44,353,924	S612R	probably benign	Het
Wdfy3	A	G	5: 101,884,138	S2273P	probably benign	Het
Wwox	G	T	8: 114,706,341	R249L	probably benign	Het
Zbtb4	G	T	11: 69,778,964	G838C	probably damaging	Het
Zkscan3	A	T	13: 21,396,291	C76S	probably damaging	Het
Znrf3	C	T	11: 5,281,776	C483Y	probably damaging	Het
Zscan2	A	G	7: 80,876,199	K556R	possibly damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGCTTACAAAGTCTCTTAGCGC -3'
(R):5'- CACTTGGAATTGTTGTCCAGATCC -3'

Sequencing Primer
(F):5'- TTAGCGCTTCTGACCCGGAAG -3'
(R):5'- AGATCCTGGGAGATGTCATCCAC -3'

Posted On

2017-06-26