Incidental Mutation 'R5988:Il21r'
ID481823
Institutional Source Beutler Lab
Gene Symbol Il21r
Ensembl Gene ENSMUSG00000030745
Gene Nameinterleukin 21 receptor
SynonymsNILR
MMRRC Submission 044168-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5988 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125603429-125633570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125632288 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 296 (F296S)
Ref Sequence ENSEMBL: ENSMUSP00000033000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]
Predicted Effect probably damaging
Transcript: ENSMUST00000033000
AA Change: F296S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745
AA Change: F296S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 120 209 3.4e0 SMART
low complexity region 239 250 N/A INTRINSIC
low complexity region 307 312 N/A INTRINSIC
low complexity region 424 450 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206103
AA Change: S264P
Predicted Effect probably benign
Transcript: ENSMUST00000206234
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.1%
  • 10x: 95.3%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,377,217 M441K probably damaging Het
Actr8 T A 14: 29,993,073 M615K possibly damaging Het
Acvr1c A T 2: 58,315,874 C25S probably damaging Het
Adk A T 14: 21,423,548 E291V probably benign Het
Ahnak C A 19: 9,009,347 probably benign Het
Alg11 A G 8: 22,062,028 T63A probably benign Het
Alox12 A T 11: 70,251,587 S272T probably benign Het
Armc10 T A 5: 21,660,583 S195T probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Baat G A 4: 49,502,871 P84S probably damaging Het
BB014433 G A 8: 15,041,854 T333I probably damaging Het
BC035947 G A 1: 78,499,206 R230* probably null Het
Bcr G A 10: 75,175,335 G26E probably benign Het
Ccdc88b T C 19: 6,855,980 E233G probably damaging Het
Cep295 A G 9: 15,341,474 F353L probably damaging Het
Chd8 T C 14: 52,217,938 M1031V probably damaging Het
Col17a1 C G 19: 47,654,220 G885R probably damaging Het
Cyp11a1 A C 9: 58,020,834 I214L probably benign Het
Cyp3a44 A T 5: 145,794,918 S139R probably damaging Het
Ddhd2 G A 8: 25,748,562 R64C probably damaging Het
Dll3 A G 7: 28,294,112 W561R probably damaging Het
Dnajc3 T C 14: 118,957,964 V97A possibly damaging Het
Drosha C T 15: 12,834,496 probably benign Het
E2f8 T C 7: 48,874,995 D302G probably damaging Het
Ecd C G 14: 20,324,561 D504H probably damaging Het
Eif4g2 C A 7: 111,077,230 V331L probably benign Het
Fam124a T C 14: 62,587,537 I160T possibly damaging Het
Fat1 A G 8: 45,029,456 T3051A probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm5039 T A 12: 88,321,432 N17I unknown Het
Gm572 A G 4: 148,668,507 E281G possibly damaging Het
Gm884 T C 11: 103,615,896 probably benign Het
Gm9944 T C 4: 144,453,205 probably benign Het
Gstm5 A C 3: 107,895,954 M1L probably benign Het
Havcr1 A G 11: 46,756,137 T133A probably damaging Het
Hey1 T G 3: 8,666,319 S68R probably damaging Het
Hsf2bp C T 17: 32,011,175 probably null Het
Id2 T C 12: 25,095,724 N96S probably benign Het
Ifi206 A C 1: 173,481,340 S363R possibly damaging Het
Irgm2 A G 11: 58,220,187 T247A probably benign Het
Irx5 T A 8: 92,360,671 Y410* probably null Het
Kmt2c A G 5: 25,311,120 I2575T probably benign Het
Lmbrd2 T A 15: 9,182,406 probably null Het
Lrig1 A C 6: 94,628,042 S191A probably damaging Het
Lypd6b T A 2: 49,946,166 C120S probably damaging Het
Mpdz A G 4: 81,284,575 probably null Het
Myh6 G T 14: 54,965,394 R23S probably damaging Het
Nat8f6 C T 6: 85,809,058 M36I probably benign Het
Nol8 T A 13: 49,672,614 M970K possibly damaging Het
Nrxn2 T C 19: 6,492,871 F1042L possibly damaging Het
Nup160 T C 2: 90,689,209 W277R probably damaging Het
Ogfr A T 2: 180,594,233 T204S probably damaging Het
Olfr136 T C 17: 38,336,020 F288L probably damaging Het
Olfr16 T A 1: 172,957,156 Y120* probably null Het
Olfr356 A G 2: 36,937,224 Y35C probably damaging Het
Olfr59 T C 11: 74,288,853 V69A probably benign Het
Olfr667 A T 7: 104,916,918 V126E probably damaging Het
Olfr898 T C 9: 38,349,749 V222A probably benign Het
Pcdh15 A G 10: 74,379,357 I648V probably benign Het
Pced1b T A 15: 97,384,347 V89E probably damaging Het
Phax G T 18: 56,575,492 A43S probably benign Het
Phf20 A G 2: 156,307,330 E976G probably damaging Het
Plin4 T C 17: 56,109,567 T8A probably benign Het
Plxna1 G A 6: 89,357,540 Q36* probably null Het
Pold1 T C 7: 44,540,580 Y394C probably damaging Het
Ppp1r26 T A 2: 28,452,554 V732E probably benign Het
Pramel5 A T 4: 144,273,146 C124S possibly damaging Het
Prr14l C A 5: 32,830,851 L433F probably damaging Het
Ptpn14 A G 1: 189,850,387 Y477C probably damaging Het
Rcl1 T A 19: 29,121,767 I154N probably damaging Het
Rfpl4 T C 7: 5,115,502 Y23C probably damaging Het
Rims1 T C 1: 22,596,463 K146E probably damaging Het
Rims2 A T 15: 39,292,182 K126M probably damaging Het
Rpusd4 T A 9: 35,272,520 probably null Het
Scn7a C T 2: 66,726,214 W342* probably null Het
Sh3pxd2a A G 19: 47,364,638 V128A probably benign Het
Slc15a5 T C 6: 138,043,531 H268R probably benign Het
Slc22a3 T C 17: 12,433,895 I321V possibly damaging Het
Slc7a6os A G 8: 106,202,333 S231P probably benign Het
Smad5 T C 13: 56,735,985 S395P probably damaging Het
Sorbs3 G A 14: 70,203,303 T20I probably benign Het
Spata9 A G 13: 75,968,117 I42V probably benign Het
Srl C T 16: 4,523,028 C9Y unknown Het
Sugp2 T C 8: 70,243,225 F283L probably benign Het
Syne2 T C 12: 75,929,417 probably null Het
Taar6 A G 10: 23,985,256 Y131H probably damaging Het
Tango2 T C 16: 18,302,690 T137A probably damaging Het
Tas2r106 T A 6: 131,678,643 I82L probably benign Het
Tbc1d32 T C 10: 56,088,337 E922G probably damaging Het
Tgfb2 G T 1: 186,704,581 P65Q probably benign Het
Tjp2 T G 19: 24,114,100 I566L probably benign Het
Tnrc6a T A 7: 123,182,380 N1424K probably damaging Het
Trim7 A T 11: 48,837,686 M54L probably benign Het
Trpm1 T A 7: 64,226,805 S535R probably benign Het
Tsc2 T A 17: 24,620,766 N417I probably damaging Het
Ttn T C 2: 76,969,788 R359G probably benign Het
Vim A G 2: 13,582,485 T458A probably benign Het
Vps11 A T 9: 44,353,924 S612R probably benign Het
Wdfy3 A G 5: 101,884,138 S2273P probably benign Het
Wwox G T 8: 114,706,341 R249L probably benign Het
Zbtb4 G T 11: 69,778,964 G838C probably damaging Het
Zkscan3 A T 13: 21,396,291 C76S probably damaging Het
Znrf3 C T 11: 5,281,776 C483Y probably damaging Het
Zscan2 A G 7: 80,876,199 K556R possibly damaging Het
Other mutations in Il21r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Il21r APN 7 125632525 missense probably damaging 1.00
bellflower UTSW 7 125628043 critical splice acceptor site probably null
R0409:Il21r UTSW 7 125629840 intron probably benign
R0573:Il21r UTSW 7 125625285 missense probably benign 0.06
R0635:Il21r UTSW 7 125632506 missense probably damaging 1.00
R1933:Il21r UTSW 7 125628981 missense possibly damaging 0.92
R1969:Il21r UTSW 7 125628972 missense probably damaging 0.99
R3716:Il21r UTSW 7 125632269 missense probably damaging 0.96
R3968:Il21r UTSW 7 125628043 critical splice acceptor site probably null
R4546:Il21r UTSW 7 125628899 missense probably damaging 1.00
R5086:Il21r UTSW 7 125632855 missense probably damaging 0.99
R5566:Il21r UTSW 7 125625298 missense probably damaging 1.00
R6234:Il21r UTSW 7 125632585 missense probably damaging 1.00
R6259:Il21r UTSW 7 125630719 missense possibly damaging 0.65
R6896:Il21r UTSW 7 125626956 missense probably damaging 1.00
R7162:Il21r UTSW 7 125632311 missense probably benign 0.00
R7263:Il21r UTSW 7 125632905 missense probably benign 0.04
R7740:Il21r UTSW 7 125632555 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAGACAGACATCATGGCGC -3'
(R):5'- TCCTCACTGTAGGCTGAGAC -3'

Sequencing Primer
(F):5'- AGACATCATGGCGCGCTCTC -3'
(R):5'- ACTGTAGGCTGAGACCGCTTG -3'
Posted On2017-06-26